ID: 1101556052

View in Genome Browser
Species Human (GRCh38)
Location 12:105810719-105810741
Sequence TTGACAACATGACGTAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101556052_1101556058 6 Left 1101556052 12:105810719-105810741 CCAGGGCTACGTCATGTTGTCAA No data
Right 1101556058 12:105810748-105810770 CTGCAATAGGTGTTGGTAAAGGG No data
1101556052_1101556057 5 Left 1101556052 12:105810719-105810741 CCAGGGCTACGTCATGTTGTCAA No data
Right 1101556057 12:105810747-105810769 ACTGCAATAGGTGTTGGTAAAGG No data
1101556052_1101556059 24 Left 1101556052 12:105810719-105810741 CCAGGGCTACGTCATGTTGTCAA No data
Right 1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG No data
1101556052_1101556053 -7 Left 1101556052 12:105810719-105810741 CCAGGGCTACGTCATGTTGTCAA No data
Right 1101556053 12:105810735-105810757 TTGTCAACCCTAACTGCAATAGG No data
1101556052_1101556054 -1 Left 1101556052 12:105810719-105810741 CCAGGGCTACGTCATGTTGTCAA No data
Right 1101556054 12:105810741-105810763 ACCCTAACTGCAATAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101556052 Original CRISPR TTGACAACATGACGTAGCCC TGG (reversed) Intergenic
No off target data available for this crispr