ID: 1101556055

View in Genome Browser
Species Human (GRCh38)
Location 12:105810742-105810764
Sequence ACCAACACCTATTGCAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101556055_1101556059 1 Left 1101556055 12:105810742-105810764 CCCTAACTGCAATAGGTGTTGGT No data
Right 1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101556055 Original CRISPR ACCAACACCTATTGCAGTTA GGG (reversed) Intergenic
No off target data available for this crispr