ID: 1101556056

View in Genome Browser
Species Human (GRCh38)
Location 12:105810743-105810765
Sequence TACCAACACCTATTGCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101556056_1101556060 30 Left 1101556056 12:105810743-105810765 CCTAACTGCAATAGGTGTTGGTA No data
Right 1101556060 12:105810796-105810818 AGATGAAGACAATATCTTCTAGG No data
1101556056_1101556059 0 Left 1101556056 12:105810743-105810765 CCTAACTGCAATAGGTGTTGGTA No data
Right 1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101556056 Original CRISPR TACCAACACCTATTGCAGTT AGG (reversed) Intergenic
No off target data available for this crispr