ID: 1101556059

View in Genome Browser
Species Human (GRCh38)
Location 12:105810766-105810788
Sequence AAGGGACTATTCATCTCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101556056_1101556059 0 Left 1101556056 12:105810743-105810765 CCTAACTGCAATAGGTGTTGGTA No data
Right 1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG No data
1101556052_1101556059 24 Left 1101556052 12:105810719-105810741 CCAGGGCTACGTCATGTTGTCAA No data
Right 1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG No data
1101556055_1101556059 1 Left 1101556055 12:105810742-105810764 CCCTAACTGCAATAGGTGTTGGT No data
Right 1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101556059 Original CRISPR AAGGGACTATTCATCTCTTG CGG Intergenic
No off target data available for this crispr