ID: 1101559739

View in Genome Browser
Species Human (GRCh38)
Location 12:105845132-105845154
Sequence GATTCTGATCAGAGGGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101559739_1101559748 20 Left 1101559739 12:105845132-105845154 CCCACGTCCCTCTGATCAGAATC No data
Right 1101559748 12:105845175-105845197 CCGATTCAGTGTAATTCAGGAGG No data
1101559739_1101559749 21 Left 1101559739 12:105845132-105845154 CCCACGTCCCTCTGATCAGAATC No data
Right 1101559749 12:105845176-105845198 CGATTCAGTGTAATTCAGGAGGG No data
1101559739_1101559746 17 Left 1101559739 12:105845132-105845154 CCCACGTCCCTCTGATCAGAATC No data
Right 1101559746 12:105845172-105845194 AATCCGATTCAGTGTAATTCAGG No data
1101559739_1101559750 30 Left 1101559739 12:105845132-105845154 CCCACGTCCCTCTGATCAGAATC No data
Right 1101559750 12:105845185-105845207 GTAATTCAGGAGGGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101559739 Original CRISPR GATTCTGATCAGAGGGACGT GGG (reversed) Intergenic
No off target data available for this crispr