ID: 1101564898

View in Genome Browser
Species Human (GRCh38)
Location 12:105895865-105895887
Sequence CAGGGGCTGTGATCCAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101564898_1101564907 30 Left 1101564898 12:105895865-105895887 CCCCTACTGGATCACAGCCCCTG No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564898_1101564904 3 Left 1101564898 12:105895865-105895887 CCCCTACTGGATCACAGCCCCTG No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101564898 Original CRISPR CAGGGGCTGTGATCCAGTAG GGG (reversed) Intergenic
No off target data available for this crispr