ID: 1101564904

View in Genome Browser
Species Human (GRCh38)
Location 12:105895891-105895913
Sequence GCACCATGAGAATATTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101564895_1101564904 9 Left 1101564895 12:105895859-105895881 CCCTTCCCCCTACTGGATCACAG No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data
1101564894_1101564904 10 Left 1101564894 12:105895858-105895880 CCCCTTCCCCCTACTGGATCACA No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data
1101564899_1101564904 2 Left 1101564899 12:105895866-105895888 CCCTACTGGATCACAGCCCCTGT No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data
1101564896_1101564904 8 Left 1101564896 12:105895860-105895882 CCTTCCCCCTACTGGATCACAGC No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data
1101564898_1101564904 3 Left 1101564898 12:105895865-105895887 CCCCTACTGGATCACAGCCCCTG No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data
1101564897_1101564904 4 Left 1101564897 12:105895864-105895886 CCCCCTACTGGATCACAGCCCCT No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data
1101564900_1101564904 1 Left 1101564900 12:105895867-105895889 CCTACTGGATCACAGCCCCTGTA No data
Right 1101564904 12:105895891-105895913 GCACCATGAGAATATTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101564904 Original CRISPR GCACCATGAGAATATTAAGA AGG Intergenic
No off target data available for this crispr