ID: 1101564907

View in Genome Browser
Species Human (GRCh38)
Location 12:105895918-105895940
Sequence CATAAATGCTTAGTGACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101564900_1101564907 28 Left 1101564900 12:105895867-105895889 CCTACTGGATCACAGCCCCTGTA No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564901_1101564907 13 Left 1101564901 12:105895882-105895904 CCCCTGTAAGCACCATGAGAATA No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564905_1101564907 1 Left 1101564905 12:105895894-105895916 CCATGAGAATATTAAGAAGGTCT No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564903_1101564907 11 Left 1101564903 12:105895884-105895906 CCTGTAAGCACCATGAGAATATT No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564902_1101564907 12 Left 1101564902 12:105895883-105895905 CCCTGTAAGCACCATGAGAATAT No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564898_1101564907 30 Left 1101564898 12:105895865-105895887 CCCCTACTGGATCACAGCCCCTG No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data
1101564899_1101564907 29 Left 1101564899 12:105895866-105895888 CCCTACTGGATCACAGCCCCTGT No data
Right 1101564907 12:105895918-105895940 CATAAATGCTTAGTGACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101564907 Original CRISPR CATAAATGCTTAGTGACAAC TGG Intergenic
No off target data available for this crispr