ID: 1101569137

View in Genome Browser
Species Human (GRCh38)
Location 12:105937039-105937061
Sequence CTGTTGTGGAGGAGGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101569137_1101569143 -10 Left 1101569137 12:105937039-105937061 CCTGATCCCCTCCTCCACAACAG No data
Right 1101569143 12:105937052-105937074 TCCACAACAGCCTTCCTGGATGG No data
1101569137_1101569146 -8 Left 1101569137 12:105937039-105937061 CCTGATCCCCTCCTCCACAACAG No data
Right 1101569146 12:105937054-105937076 CACAACAGCCTTCCTGGATGGGG No data
1101569137_1101569145 -9 Left 1101569137 12:105937039-105937061 CCTGATCCCCTCCTCCACAACAG No data
Right 1101569145 12:105937053-105937075 CCACAACAGCCTTCCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101569137 Original CRISPR CTGTTGTGGAGGAGGGGATC AGG (reversed) Intergenic
No off target data available for this crispr