ID: 1101569601

View in Genome Browser
Species Human (GRCh38)
Location 12:105940991-105941013
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101569601_1101569610 25 Left 1101569601 12:105940991-105941013 CCCCTCCCTCTCTCCTCTCTGCT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569601_1101569609 22 Left 1101569601 12:105940991-105941013 CCCCTCCCTCTCTCCTCTCTGCT No data
Right 1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101569601 Original CRISPR AGCAGAGAGGAGAGAGGGAG GGG (reversed) Intergenic
No off target data available for this crispr