ID: 1101569604

View in Genome Browser
Species Human (GRCh38)
Location 12:105940996-105941018
Sequence AGCAGAGCAGAGAGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101569604_1101569609 17 Left 1101569604 12:105940996-105941018 CCCTCTCTCCTCTCTGCTCTGCT No data
Right 1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG No data
1101569604_1101569610 20 Left 1101569604 12:105940996-105941018 CCCTCTCTCCTCTCTGCTCTGCT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569604_1101569613 29 Left 1101569604 12:105940996-105941018 CCCTCTCTCCTCTCTGCTCTGCT No data
Right 1101569613 12:105941048-105941070 CCTCCTTATGGTGGCAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101569604 Original CRISPR AGCAGAGCAGAGAGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr