ID: 1101569605

View in Genome Browser
Species Human (GRCh38)
Location 12:105940997-105941019
Sequence AAGCAGAGCAGAGAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101569605_1101569613 28 Left 1101569605 12:105940997-105941019 CCTCTCTCCTCTCTGCTCTGCTT No data
Right 1101569613 12:105941048-105941070 CCTCCTTATGGTGGCAACATTGG No data
1101569605_1101569610 19 Left 1101569605 12:105940997-105941019 CCTCTCTCCTCTCTGCTCTGCTT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569605_1101569609 16 Left 1101569605 12:105940997-105941019 CCTCTCTCCTCTCTGCTCTGCTT No data
Right 1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101569605 Original CRISPR AAGCAGAGCAGAGAGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr