ID: 1101569606

View in Genome Browser
Species Human (GRCh38)
Location 12:105941004-105941026
Sequence TAGCACAAAGCAGAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101569606_1101569609 9 Left 1101569606 12:105941004-105941026 CCTCTCTGCTCTGCTTTGTGCTA No data
Right 1101569609 12:105941036-105941058 CCAAACAAGCTCCCTCCTTATGG No data
1101569606_1101569613 21 Left 1101569606 12:105941004-105941026 CCTCTCTGCTCTGCTTTGTGCTA No data
Right 1101569613 12:105941048-105941070 CCTCCTTATGGTGGCAACATTGG No data
1101569606_1101569610 12 Left 1101569606 12:105941004-105941026 CCTCTCTGCTCTGCTTTGTGCTA No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101569606 Original CRISPR TAGCACAAAGCAGAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr