ID: 1101569610

View in Genome Browser
Species Human (GRCh38)
Location 12:105941039-105941061
Sequence AACAAGCTCCCTCCTTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101569606_1101569610 12 Left 1101569606 12:105941004-105941026 CCTCTCTGCTCTGCTTTGTGCTA No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569602_1101569610 24 Left 1101569602 12:105940992-105941014 CCCTCCCTCTCTCCTCTCTGCTC No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569604_1101569610 20 Left 1101569604 12:105940996-105941018 CCCTCTCTCCTCTCTGCTCTGCT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569605_1101569610 19 Left 1101569605 12:105940997-105941019 CCTCTCTCCTCTCTGCTCTGCTT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569603_1101569610 23 Left 1101569603 12:105940993-105941015 CCTCCCTCTCTCCTCTCTGCTCT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data
1101569601_1101569610 25 Left 1101569601 12:105940991-105941013 CCCCTCCCTCTCTCCTCTCTGCT No data
Right 1101569610 12:105941039-105941061 AACAAGCTCCCTCCTTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101569610 Original CRISPR AACAAGCTCCCTCCTTATGG TGG Intergenic
No off target data available for this crispr