ID: 1101572147

View in Genome Browser
Species Human (GRCh38)
Location 12:105963414-105963436
Sequence AGCTATCTGCAGAATATAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101572145_1101572147 9 Left 1101572145 12:105963382-105963404 CCTTTATTTTTTTTCACAGAAGT No data
Right 1101572147 12:105963414-105963436 AGCTATCTGCAGAATATAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101572147 Original CRISPR AGCTATCTGCAGAATATAAC GGG Intergenic
No off target data available for this crispr