ID: 1101574364

View in Genome Browser
Species Human (GRCh38)
Location 12:105983805-105983827
Sequence CTGTGGTCAGGGAGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101574358_1101574364 -6 Left 1101574358 12:105983788-105983810 CCAAACATTTTCATTAGCTGTGG No data
Right 1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG No data
1101574355_1101574364 30 Left 1101574355 12:105983752-105983774 CCTTTAAAGAATAACACAGATTC No data
Right 1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG No data
1101574357_1101574364 3 Left 1101574357 12:105983779-105983801 CCAGGCGAGCCAAACATTTTCAT No data
Right 1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101574364 Original CRISPR CTGTGGTCAGGGAGGGAATC AGG Intergenic
No off target data available for this crispr