ID: 1101574539

View in Genome Browser
Species Human (GRCh38)
Location 12:105985293-105985315
Sequence GGTTTAATGGCATCATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101574539_1101574542 -2 Left 1101574539 12:105985293-105985315 CCAGGTGATGATGCCATTAAACC No data
Right 1101574542 12:105985314-105985336 CCTTTATGTTGATAAGTCATTGG No data
1101574539_1101574543 10 Left 1101574539 12:105985293-105985315 CCAGGTGATGATGCCATTAAACC No data
Right 1101574543 12:105985326-105985348 TAAGTCATTGGATGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101574539 Original CRISPR GGTTTAATGGCATCATCACC TGG (reversed) Intergenic
No off target data available for this crispr