ID: 1101579900

View in Genome Browser
Species Human (GRCh38)
Location 12:106033147-106033169
Sequence CCTCACATCCTACCCAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101579893_1101579900 -1 Left 1101579893 12:106033125-106033147 CCGCGGTGACATCTCCTGCCCTC No data
Right 1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG No data
1101579891_1101579900 6 Left 1101579891 12:106033118-106033140 CCTGTGCCCGCGGTGACATCTCC No data
Right 1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG No data
1101579892_1101579900 0 Left 1101579892 12:106033124-106033146 CCCGCGGTGACATCTCCTGCCCT No data
Right 1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG No data
1101579889_1101579900 24 Left 1101579889 12:106033100-106033122 CCGCTGCTGCTTTTCTCTCCTGT No data
Right 1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101579900 Original CRISPR CCTCACATCCTACCCAGGTT GGG Intergenic
No off target data available for this crispr