ID: 1101582387

View in Genome Browser
Species Human (GRCh38)
Location 12:106053391-106053413
Sequence ACCACCCAGAAACTCCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101582383_1101582387 -6 Left 1101582383 12:106053374-106053396 CCCTAACTTCTCTCCTAACCACC No data
Right 1101582387 12:106053391-106053413 ACCACCCAGAAACTCCACTAGGG No data
1101582384_1101582387 -7 Left 1101582384 12:106053375-106053397 CCTAACTTCTCTCCTAACCACCC No data
Right 1101582387 12:106053391-106053413 ACCACCCAGAAACTCCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101582387 Original CRISPR ACCACCCAGAAACTCCACTA GGG Intergenic
No off target data available for this crispr