ID: 1101583264

View in Genome Browser
Species Human (GRCh38)
Location 12:106062883-106062905
Sequence AGGCACTCCCCTCTATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101583264_1101583269 -9 Left 1101583264 12:106062883-106062905 CCTTGGGATAGAGGGGAGTGCCT 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1101583269 12:106062897-106062919 GGAGTGCCTAGGGAAAGGGCAGG 0: 1
1: 0
2: 0
3: 23
4: 344
1101583264_1101583271 -3 Left 1101583264 12:106062883-106062905 CCTTGGGATAGAGGGGAGTGCCT 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1101583271 12:106062903-106062925 CCTAGGGAAAGGGCAGGCACAGG 0: 1
1: 0
2: 2
3: 28
4: 360
1101583264_1101583272 11 Left 1101583264 12:106062883-106062905 CCTTGGGATAGAGGGGAGTGCCT 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1101583272 12:106062917-106062939 AGGCACAGGAAACTGAAATGTGG 0: 1
1: 0
2: 2
3: 53
4: 416
1101583264_1101583273 24 Left 1101583264 12:106062883-106062905 CCTTGGGATAGAGGGGAGTGCCT 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1101583273 12:106062930-106062952 TGAAATGTGGAGAAAGAGCGTGG 0: 1
1: 0
2: 2
3: 14
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101583264 Original CRISPR AGGCACTCCCCTCTATCCCA AGG (reversed) Intergenic
900916853 1:5645295-5645317 GGGCCCTCCCCTCCATCCCTGGG - Intergenic
900960563 1:5916630-5916652 AGGCACACTCCTCTCTGCCAAGG + Intronic
901422272 1:9159104-9159126 AGCCACTCTCCTCTCTGCCATGG - Intergenic
902490286 1:16776326-16776348 TGGCTCTTCCCTCTATGCCAAGG - Intronic
903171868 1:21559258-21559280 CGGGGCTCCCCTCTGTCCCAGGG - Intronic
904261142 1:29288549-29288571 AGACTCTCCCCTCTCTCCCTGGG + Intronic
906263419 1:44409907-44409929 AAGCACTCCCCCCTCCCCCATGG + Intronic
909091734 1:71234048-71234070 AGGCATTCTCCTCTATCCCTAGG + Intergenic
909699866 1:78511068-78511090 AGGCACTCAACTCCAACCCATGG - Intronic
913670685 1:121094992-121095014 AGGGACTCCCTTATCTCCCATGG + Intronic
914022449 1:143882434-143882456 AGGGACTCCCTTATCTCCCATGG + Intergenic
914660933 1:149790376-149790398 AGGGACTCCCTTATCTCCCATGG + Intronic
915206343 1:154273059-154273081 AGTCCCTCCTCTCTCTCCCAAGG - Intronic
915752865 1:158228305-158228327 GGGGACTTCCCTCTAGCCCAGGG - Intergenic
916768215 1:167882533-167882555 AGGCAGTCCCCTCCCTGCCATGG + Intronic
917921174 1:179751207-179751229 AGGCACTCTCATCCATGCCATGG - Intronic
922065267 1:222131554-222131576 CTGCACTCCCTTCTCTCCCAGGG - Intergenic
922324795 1:224517907-224517929 AGGCACCCCCATCATTCCCAAGG - Intronic
923530154 1:234806204-234806226 TGGCTCTTCCCTCTATGCCAAGG + Intergenic
1063250058 10:4264269-4264291 AGGCAGTGCCCCCAATCCCAGGG - Intergenic
1063323299 10:5072677-5072699 AGACAGTCACCTTTATCCCAAGG - Intronic
1064115409 10:12573223-12573245 AGGCCCTGCTTTCTATCCCAGGG - Intronic
1065109086 10:22422574-22422596 AGGCACTCTTGTCTATGCCAGGG + Intronic
1067669222 10:48304494-48304516 AGGCTGACCCATCTATCCCAAGG + Intergenic
1070732490 10:78841015-78841037 AGGCCCTCCCTTCTATTTCACGG - Intergenic
1071258447 10:83896470-83896492 AGGCAGTACCCTCTCTGCCAAGG + Intergenic
1074199395 10:111221267-111221289 AAGCTCTGCCCTGTATCCCAGGG - Intergenic
1074535970 10:114328890-114328912 AGGCACCCACCTCTACCCCAGGG - Intronic
1074824726 10:117206570-117206592 AGGCACTCCCCCATCTGCCATGG + Intronic
1080466944 11:32506556-32506578 AGGCACACACCTCTATGCCTGGG + Intergenic
1081957654 11:47107511-47107533 ATGCAGTCCACTCTATCTCAGGG + Intronic
1082195326 11:49298082-49298104 ATGCATTCCCCTCTGGCCCAGGG + Intergenic
1082586175 11:54943838-54943860 ATGCACTCCCATATATCCCATGG + Intergenic
1084642853 11:70436059-70436081 AGGCACTGCCTTCCTTCCCAAGG - Intronic
1085572101 11:77568692-77568714 AAGGACTCCCCTCTGGCCCAGGG + Intronic
1086660606 11:89411470-89411492 ATGCATTCCCCTCTGGCCCAGGG - Intronic
1086837794 11:91647091-91647113 AGCCACTATCCTCTTTCCCATGG + Intergenic
1087887602 11:103498055-103498077 GTGCACTCCCCTCTCACCCAGGG - Intergenic
1089289531 11:117429304-117429326 AGGCGTTCCCCTCTTTCCCATGG + Intronic
1092398223 12:8146920-8146942 AGTCATGCCCCTCTTTCCCACGG - Intronic
1095074721 12:37904242-37904264 ATGCACTCCCAAATATCCCATGG + Intergenic
1096110488 12:49026341-49026363 TGCCACTGCCCTCTATCCCGTGG - Exonic
1097118220 12:56714757-56714779 AGGCATTCACCTCTAGTCCAGGG - Intronic
1101583264 12:106062883-106062905 AGGCACTCCCCTCTATCCCAAGG - Intergenic
1101806294 12:108067148-108067170 AGGCACTCCACTCTAACCCTGGG - Intergenic
1104041650 12:125134696-125134718 AGTCACCCCCCACTTTCCCATGG - Intronic
1106559718 13:30837800-30837822 AGGGAGTCCTGTCTATCCCAAGG - Intergenic
1107809678 13:44188411-44188433 AGGCAGGACCCTCTTTCCCAGGG - Intergenic
1109747675 13:66647802-66647824 ATGGGCTCCCCTCTAGCCCAGGG - Intronic
1113217645 13:108061080-108061102 AGGGACTCCCCTCTGGCCCAGGG - Intergenic
1113874186 13:113584543-113584565 AGCCCCTCCCCGCTCTCCCAGGG + Intergenic
1116325424 14:43527705-43527727 AGGCGCTCCCCAGTATCACAGGG - Intergenic
1118353282 14:64989895-64989917 ACCCTATCCCCTCTATCCCAAGG - Intronic
1123024784 14:105419608-105419630 AGGATCTCCCCTCTACCCCCAGG + Intronic
1123049446 14:105533652-105533674 AGGCACTCCCGTCGCCCCCACGG - Intergenic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1129677648 15:77641114-77641136 TGTCTCTCCCCTCCATCCCAGGG - Intronic
1131227750 15:90639256-90639278 ACGCACTCCCCTCACTCCCCAGG - Intronic
1132514318 16:359251-359273 AGGCGGTCCCCTCCATCCCAGGG + Intergenic
1132654834 16:1037410-1037432 AGGCACCCCCCTCCACCCCACGG - Intergenic
1133257249 16:4524653-4524675 AGGCACTGGCCTCCATCCCAAGG - Intronic
1133441322 16:5823468-5823490 AGGCACTGCCCTCTATGGCTGGG + Intergenic
1133986922 16:10675832-10675854 AAGCAGTACCCTCTCTCCCAAGG - Intronic
1134530485 16:14979021-14979043 AGGCAATTCCCTCTACCCCTTGG - Intronic
1134638731 16:15812107-15812129 AGGGATCCCCCTCAATCCCACGG - Intronic
1138509006 16:57497224-57497246 GGGCACACCCCTCTAGCTCATGG + Intergenic
1138867755 16:60844313-60844335 ACTCGCTCACCTCTATCCCAGGG + Intergenic
1139374463 16:66488089-66488111 AGCCACTCTCATCTTTCCCAGGG - Intronic
1139865860 16:70061946-70061968 AGGCAATTCCCTCTACCCCTTGG + Intergenic
1139962070 16:70723886-70723908 AGGTCCTCCCCTCCATCACAGGG + Intronic
1140300824 16:73755900-73755922 AGGCACTCGCCCCTCTCCCACGG + Intergenic
1141986187 16:87581945-87581967 AGGCCCTCCCTCCTCTCCCAAGG + Intergenic
1146242517 17:31243710-31243732 TGGGGCTCCCCTCTAACCCAGGG + Intronic
1148468314 17:47877968-47877990 GGACACTCTCCTCTAGCCCATGG - Intergenic
1148622452 17:49044653-49044675 AGTCACTGCCCTCTATCCGTTGG + Intronic
1150153615 17:62831501-62831523 ATGCACTACCCTCTAGGCCAAGG + Intergenic
1151875636 17:76866843-76866865 AGGTACTCCCCTCTTCCCCTGGG - Intergenic
1152144566 17:78560683-78560705 AGGCCCTCCCCCCGCTCCCAAGG + Intronic
1152232506 17:79121156-79121178 AGGCCCTCCCTTCTGTCCCCAGG + Intronic
1152769336 17:82157738-82157760 GGGCACCCACCTCTCTCCCAAGG + Exonic
1154102603 18:11489877-11489899 AGGGACTTCCCTATCTCCCAGGG + Intergenic
1156376795 18:36521857-36521879 AGCCACTCCCTGCCATCCCAGGG + Intronic
1156973637 18:43189592-43189614 TGGCTCTACTCTCTATCCCAGGG - Intergenic
1157272377 18:46286030-46286052 GGGCACTCCCCTCCCTCCCAAGG - Intergenic
1157807983 18:50672550-50672572 AGGCTCTTCCCTCTGTCCCTGGG + Intronic
1159501339 18:69274754-69274776 AAGCACTTCCCTCTAACCAACGG - Intergenic
1161682453 19:5687014-5687036 CGGCCCGCCCCTCTATCTCAGGG + Intronic
1162821370 19:13225477-13225499 GGGCACTCCCTTCCAGCCCAGGG + Intronic
1164589019 19:29496008-29496030 TGTCTCTCCCCTCTGTCCCAGGG - Intergenic
1165954674 19:39494821-39494843 AGGCACACTCAGCTATCCCAGGG - Intergenic
1165994163 19:39832980-39833002 AGGCACCCCTCTTTATACCAGGG + Intronic
1167436416 19:49481152-49481174 ATCCACTCCACTCCATCCCATGG - Intronic
933162886 2:79045277-79045299 GTGCACTCCCCTCTGGCCCAGGG - Intergenic
934055767 2:88250232-88250254 AGGCCCTTCCCTCTGTCCCAGGG + Intergenic
935069643 2:99682680-99682702 AAGCACTCCTTTCTATCACAGGG + Intronic
937308655 2:120887758-120887780 AGTCACTCCACTGTTTCCCAAGG - Intronic
938657207 2:133446792-133446814 TGCCTCTCCCCTCTCTCCCATGG - Intronic
940255481 2:151724016-151724038 AGACACTCCCCTCTGCCCCCAGG + Intronic
940804328 2:158168995-158169017 AACCACTACCCTCAATCCCATGG - Intergenic
941005099 2:160239810-160239832 AAGCCCTCCTCTCTTTCCCATGG - Intronic
945990486 2:216391952-216391974 TGGCAGTCCCACCTATCCCAAGG - Intergenic
946483774 2:220081276-220081298 AGGCACTCTCCTGCATACCAAGG + Intergenic
947871679 2:233442143-233442165 AGGCTCTCCCCTCTCTGCCCTGG - Intronic
947893054 2:233643448-233643470 GTGGGCTCCCCTCTATCCCAGGG + Intronic
948481299 2:238252131-238252153 AGGCCCCGCCCTCAATCCCAAGG - Intronic
948708513 2:239810709-239810731 AGGCTGACCCCTCCATCCCATGG + Intergenic
1169027390 20:2382344-2382366 AGGCAATCCCCTCTGCACCAGGG - Intronic
1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG + Intronic
1173187383 20:40850794-40850816 AGACCTTCCCGTCTATCCCAAGG - Intergenic
1174299530 20:49571376-49571398 AGGAAGACCCCTCTAGCCCATGG + Intergenic
1174504038 20:51005157-51005179 AGGCAATCCCATCTTTCCAATGG + Intronic
1174720164 20:52803204-52803226 TGGTACTCCCCTCTTTCTCAGGG + Intergenic
1175635361 20:60578383-60578405 AAGTACTCCTCTCCATCCCAGGG - Intergenic
1175886132 20:62291907-62291929 AGGCACTCCCCGCCGTCCCCAGG - Intronic
1177271477 21:18853732-18853754 AGGCATTCCTCTCTGACCCATGG - Intergenic
1179395947 21:41040087-41040109 ATGGGCTCCCCTCTAGCCCAGGG - Intergenic
1180830377 22:18902837-18902859 AGTCACTCCACACTAACCCAAGG + Intergenic
1182316922 22:29453892-29453914 AGGCACTCTCCTCTGCCCCCCGG - Intergenic
1182673776 22:32020380-32020402 AGTCACTCTCTTCTTTCCCAGGG - Intergenic
1183506614 22:38212744-38212766 AGCCAGTCCCCTCTCTCCCCAGG - Intronic
1203280466 22_KI270734v1_random:128108-128130 AGTCACTCCACACTAACCCAAGG + Intergenic
950562844 3:13745406-13745428 AGGCACTCCCCATGTTCCCATGG - Intergenic
952132786 3:30384302-30384324 GTGGACTCCCCTCTGTCCCAAGG + Intergenic
952203109 3:31151534-31151556 GTGCACTCCCCTCTGGCCCAGGG + Intergenic
955350317 3:58188796-58188818 ACGCACTCAGCTCTTTCCCAGGG - Intergenic
956476145 3:69621992-69622014 ATGGGCTCCCCTCTACCCCAGGG - Intergenic
956781198 3:72604843-72604865 AGGCAGTCCCTACTATCCCGGGG + Intergenic
964017290 3:151963285-151963307 AGGCACTCCTTTCTAAGCCAAGG - Intergenic
966452082 3:180074165-180074187 ATACACTCCCCTCTGGCCCAGGG - Intergenic
967876466 3:194271274-194271296 AGGCCCTCCCCTCTATCCCAGGG - Intergenic
969059004 4:4420370-4420392 AATCACTCCCTTCTGTCCCAGGG + Intronic
970931235 4:21514808-21514830 AGGCTCTCCACTCCTTCCCAAGG + Intronic
972355263 4:38274557-38274579 ATCCACTCCCCTGTCTCCCAGGG - Intergenic
976115652 4:81723008-81723030 AGGCACTCCCCTCCAAAGCATGG + Intronic
980800106 4:137735910-137735932 GGGCATTCCCCTCTAGCCCAGGG + Intergenic
985746691 5:1652166-1652188 AGGCACCCCCTTCTTCCCCAGGG - Intergenic
986192650 5:5511399-5511421 AAGCACTCAGCTCTATCTCATGG - Intergenic
986192994 5:5514257-5514279 AGACAGACCCCTCAATCCCAAGG - Intergenic
986383308 5:7207880-7207902 AGCCACTCCCCTCATACCCATGG - Intergenic
989184444 5:38609759-38609781 ACCCACTCCCCTCAGTCCCAGGG + Intergenic
990241380 5:53819774-53819796 AGGCTCTCCCCTCAGTGCCACGG + Intergenic
992717224 5:79522734-79522756 AGGCACTCTCCTCTCTCTTATGG - Intergenic
995278555 5:110307174-110307196 ATGGACTCCCCTCTGGCCCAGGG + Intronic
995549536 5:113267105-113267127 TCACACTCCCCTGTATCCCAGGG + Intronic
996077564 5:119214905-119214927 TGGCACATCCCTCTATTCCATGG + Intronic
1001045255 5:168366353-168366375 AGGCACTTCCTTGTTTCCCATGG + Intronic
1002093868 5:176819526-176819548 AGCCTCTTCCCTCTATCCCAAGG + Intronic
1002164906 5:177338091-177338113 AGGCTCTACCCTCTATACTAGGG + Intronic
1002306029 5:178283874-178283896 ATTCATTCCTCTCTATCCCAGGG + Intronic
1002891868 6:1340340-1340362 AGGCAGTCCCTTCTATCTGAGGG + Intergenic
1003679835 6:8242000-8242022 AGGTCCTTCCCTCTGTCCCATGG + Intergenic
1007610797 6:43147553-43147575 AGGCTCTGCCCTTTCTCCCAGGG + Intronic
1007729322 6:43936266-43936288 AGGCACACACATCTACCCCAGGG - Intergenic
1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG + Intergenic
1011271110 6:85580586-85580608 ATGCACTCCCCTTTGGCCCAGGG - Intronic
1011714670 6:90092878-90092900 AGGCACTCCCATCACTACCATGG - Intronic
1017791684 6:157805276-157805298 TGTCTCTCCCCTCTATCCCTGGG + Intronic
1019280069 7:195156-195178 AGGTTCTCCCCTCTACTCCAGGG + Intronic
1023043931 7:36195385-36195407 AGGAACCCACCTCTATACCATGG - Intronic
1023124274 7:36939691-36939713 GGGCACCCCCCGCCATCCCAGGG - Intronic
1023630159 7:42155691-42155713 GCCCACTCCCTTCTATCCCAGGG - Intronic
1024367926 7:48544426-48544448 AGCCACACCCCTCAATCTCAGGG + Intronic
1026969884 7:74461304-74461326 AGGGTCTCCCCTCTGTCACAGGG - Intronic
1033377665 7:140779165-140779187 AGCCAATCACCTCTCTCCCAAGG - Intronic
1034082284 7:148290317-148290339 AAGCACAACCCTCTATCACATGG + Intronic
1034248022 7:149663944-149663966 ATATACTCACCTCTATCCCAAGG - Intergenic
1036014430 8:4766650-4766672 AGGCACTCCCATGGAGCCCATGG + Intronic
1037237110 8:16733184-16733206 TGGCACTCCCCTTTAACCCTAGG - Intergenic
1037689307 8:21169458-21169480 AGTCCATCCCCTCTATCCCCAGG - Intergenic
1039079054 8:33718057-33718079 CAGCCCTCCCCTCCATCCCAAGG - Intergenic
1044873119 8:96639608-96639630 AGGCACTGCCCTCTATACTGAGG + Intergenic
1047712624 8:127567603-127567625 AGGCACTTCCTTCTCTGCCAAGG + Intergenic
1047797126 8:128268950-128268972 AGGTATTCCCATCTCTCCCAAGG + Intergenic
1049332949 8:142064885-142064907 AAGCAGCCCCCTCTGTCCCAGGG - Intergenic
1055475219 9:76656753-76656775 AGGCACTTACCTCTATCCAGGGG - Intronic
1059326215 9:113505381-113505403 AGGCTCTTGCCTCTACCCCAAGG - Intronic
1062380099 9:136282921-136282943 AGTCTGTCCCCTCTGTCCCATGG - Intronic
1062426290 9:136507664-136507686 AGGCCCTCACCTCTATCCTATGG - Intronic
1192190523 X:68988642-68988664 TGGTACACCCCACTATCCCAAGG - Intergenic
1194546405 X:95240017-95240039 GGGAACTCCCTTCTAGCCCAGGG - Intergenic
1195834870 X:109102830-109102852 GTGGACTCCCCTCTGTCCCAAGG + Intergenic
1197602597 X:128547966-128547988 GTGCACTCCCCTCTGGCCCAGGG + Intergenic
1199081226 X:143578982-143579004 GTGCACTCCCCTCTGTCACAGGG + Intergenic
1200248807 X:154541418-154541440 AGGCAGGCCGCTCTCTCCCATGG + Intronic