ID: 1101586577

View in Genome Browser
Species Human (GRCh38)
Location 12:106090553-106090575
Sequence CCATAACTACAAAGAGTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101586569_1101586577 25 Left 1101586569 12:106090505-106090527 CCATTTTACAGATGAGAACACCT 0: 1
1: 9
2: 207
3: 1588
4: 6383
Right 1101586577 12:106090553-106090575 CCATAACTACAAAGAGTACGAGG 0: 1
1: 0
2: 0
3: 2
4: 86
1101586574_1101586577 5 Left 1101586574 12:106090525-106090547 CCTGGGGCGACAAGGTGAATAAT 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1101586577 12:106090553-106090575 CCATAACTACAAAGAGTACGAGG 0: 1
1: 0
2: 0
3: 2
4: 86
1101586567_1101586577 27 Left 1101586567 12:106090503-106090525 CCCCATTTTACAGATGAGAACAC 0: 11
1: 336
2: 1883
3: 5506
4: 10677
Right 1101586577 12:106090553-106090575 CCATAACTACAAAGAGTACGAGG 0: 1
1: 0
2: 0
3: 2
4: 86
1101586568_1101586577 26 Left 1101586568 12:106090504-106090526 CCCATTTTACAGATGAGAACACC 0: 1
1: 101
2: 966
3: 4131
4: 10328
Right 1101586577 12:106090553-106090575 CCATAACTACAAAGAGTACGAGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101586577 Original CRISPR CCATAACTACAAAGAGTACG AGG Intronic
906643017 1:47452755-47452777 CCAAAACTACAAAGACTTGGAGG + Intergenic
910997639 1:93125622-93125644 CCATAAACACAAACAGTACATGG + Intronic
912871210 1:113308574-113308596 ACATACCTTCAAAGGGTACGTGG - Intergenic
918322508 1:183377707-183377729 CAATAACAACAAAAAGTACAAGG + Intronic
923261969 1:232276193-232276215 CCATAACAACGAAAAGTACAGGG - Intergenic
1070270650 10:74951457-74951479 CCATCTCTACAAAGAATACAAGG - Intronic
1071134221 10:82435022-82435044 CCATAAATACAAAGAGGAGCTGG - Intronic
1073859989 10:107727079-107727101 ACATAACTACAAATATTACCTGG - Intergenic
1081166387 11:39813490-39813512 CCAGAGGTACAAAGAGTAGGTGG + Intergenic
1081343453 11:41955552-41955574 CCTTAACTAAAAAGAGGAAGAGG + Intergenic
1084850954 11:71939808-71939830 CCAAGACTAAAAAGAGTACCTGG - Intronic
1087119659 11:94560265-94560287 CCATAATTAAACAGAGTAAGTGG + Intronic
1087840829 11:102919412-102919434 CCATAACTCAAAAGAGTCCTGGG + Intergenic
1101586577 12:106090553-106090575 CCATAACTACAAAGAGTACGAGG + Intronic
1104381417 12:128311334-128311356 CCATAATTACAGTGAGTACCAGG - Intronic
1105487367 13:20849584-20849606 CCATAATTATAAAGGTTACGTGG - Intronic
1108144975 13:47467103-47467125 CCAAAAATACAAAGAGTAGCTGG + Intergenic
1114006773 14:18322201-18322223 TAATAACAACAAAGAGTACTGGG + Intergenic
1114561237 14:23592338-23592360 CCAAAACTACAAAAAGTAGCTGG - Intergenic
1116308502 14:43290187-43290209 CCAAAACTACAAATAATAAGGGG + Intergenic
1116483085 14:45414958-45414980 CCAGAAGTACAAAGAGTAGCTGG + Intergenic
1117136478 14:52739570-52739592 CCATGACTAAAAAGAGTATTTGG + Intronic
1122511445 14:102271718-102271740 CCAAAACTACAAAAATTAGGTGG - Intronic
1128568569 15:68717150-68717172 CCAAAAATACAAAAAGTACCTGG + Intronic
1130738934 15:86577669-86577691 CCATAGCTACACACAGCACGGGG - Intronic
1142560192 17:805062-805084 TCATACCTACAAAAAGGACGAGG + Exonic
1156732405 18:40210271-40210293 CCATAACTATGTAGAGTAGGTGG - Intergenic
1159190607 18:65036803-65036825 GCATACTTACAAATAGTACGTGG + Intergenic
1159978209 18:74742126-74742148 CCAAAACTATAGAGAGTAGGAGG - Intronic
1161048788 19:2151238-2151260 CCGTAACCACAAGGAGGACGAGG - Exonic
1161474899 19:4479161-4479183 CCAAAACTACAAAGATTAGCCGG + Intronic
1161865631 19:6830218-6830240 CCAAAACTACAAAGATTAGCTGG - Intronic
926793865 2:16602781-16602803 CCATTAATACAAAGAGTAAATGG + Intronic
928011459 2:27611857-27611879 CCATAACTACAAAAATTAGCCGG - Intronic
933053344 2:77629744-77629766 ACATAACTACAAAGAGTATTAGG + Intergenic
942350206 2:175044607-175044629 CCATAAATACAAAGAGGAGCTGG - Intergenic
943410113 2:187536146-187536168 CCAGAAGTACAAAGAGTAGCTGG + Intronic
944104620 2:196066439-196066461 CCATAACTAGAAAAAGTGCTGGG + Intronic
1169395199 20:5222942-5222964 CCATAACCACAATGAGCAAGTGG - Intergenic
1172089216 20:32415771-32415793 GCATAAAGACAAAGAGTAAGGGG - Intronic
1180431282 22:15253013-15253035 TAATAACAACAAAGAGTACTGGG + Intergenic
1182464905 22:30508756-30508778 CTAAAACTACAAAGATTACCTGG + Intergenic
954271175 3:49510591-49510613 CCATAACCACAGAGAGCAGGAGG - Exonic
955324190 3:57997083-57997105 CCATCTCTACAAAAAGTACAGGG - Intergenic
955767365 3:62358968-62358990 CCAGGACTACAAAGAGAAGGCGG + Intergenic
959258924 3:104050122-104050144 CCAGAACTACAAAGAGGAGCTGG + Intergenic
959479724 3:106856635-106856657 CCAGAAGTACAAAGAGGACCTGG + Intergenic
959641304 3:108639560-108639582 CCATGACTACTAAGAGAATGGGG - Intronic
960276901 3:115738953-115738975 CCAGAACTACAAAGAGGAGCTGG - Intergenic
961196072 3:125002494-125002516 CCATGAGTACAAAGAGAAAGAGG + Intronic
973837818 4:54828334-54828356 CCAGAACTACAAAGAGCAGCTGG + Intergenic
975424638 4:74211762-74211784 CCATAAGTACAAAGAGCAGCTGG - Intronic
977331429 4:95642040-95642062 CCAAAAATACAAAAAGTACCAGG - Intergenic
978977440 4:114895549-114895571 CCAGAACTACAAAGAGGAACTGG + Intronic
980346491 4:131628236-131628258 CCAGAAGTACAAAGAGTATCTGG + Intergenic
980650742 4:135711895-135711917 CCAAAACTGCAAAGAGCAGGGGG - Intergenic
983662049 4:170138523-170138545 CCATATCTAAAAAGAGTGGGTGG + Intergenic
987703956 5:21439844-21439866 CCATAAATACAATGAGTTAGAGG + Intergenic
990696090 5:58419357-58419379 AAATAACTACAAAGGGTACCTGG - Intergenic
995003336 5:107161343-107161365 CCAGAAATACAAAGAGTAGCTGG + Intergenic
995666492 5:114548022-114548044 CCAGAAATACAAAGAGTAGCTGG + Intergenic
998449612 5:142223928-142223950 CCAAAACTACAAAGACTAGCTGG + Intergenic
999522021 5:152360418-152360440 CGATATCTACATAGAGTAGGTGG + Intergenic
1000420981 5:161037464-161037486 CCAGAAATACAAAGAGTAGTTGG + Intergenic
1000482762 5:161800475-161800497 CCATAATTACAAAGTCTACTGGG - Intergenic
1003579896 6:7330224-7330246 CCAAAAATACAAAGATTACCTGG + Intronic
1004879390 6:19992068-19992090 CCCTAACTTCAAAGAGGACTTGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1010627598 6:78157608-78157630 CCATAACAACAAAGAATACTTGG + Intergenic
1012612698 6:101235422-101235444 CCATAAATATAAAGAATACATGG - Intergenic
1014925402 6:127265031-127265053 CCACAACTGCAAAGACTATGAGG + Intergenic
1016823401 6:148366757-148366779 CCAAAAATACAAAAATTACGCGG - Intronic
1018460108 6:163990274-163990296 TCATATCTACAAAAAGTACCTGG + Intergenic
1033534399 7:142298689-142298711 CCATAAGTAGAAAGAGGAAGGGG + Intergenic
1038185466 8:25269935-25269957 CCAACTCTCCAAAGAGTACGGGG + Intronic
1038709285 8:29926453-29926475 AAAGAACTACAAAGAGTAAGTGG + Intergenic
1041240043 8:55841536-55841558 CTAAAACTACAAAGATTAGGCGG + Intergenic
1042171438 8:65995354-65995376 CCAGAAGTACAAAGAGTAGCTGG - Intergenic
1042289282 8:67151467-67151489 CCAGAACTACAAACAATACCAGG - Intronic
1042380666 8:68109946-68109968 CCTGAACTACAAAGAATACAAGG - Intronic
1048598633 8:135894602-135894624 CCATGACTACCAAGAGAAGGTGG + Intergenic
1048634778 8:136284103-136284125 CCAAAAGTACAAAGAGCCCGTGG - Intergenic
1051811016 9:21049657-21049679 CCATAACTACTATGAGGATGAGG - Intergenic
1052224963 9:26074701-26074723 CCAGAAATACAAAGAGTAGATGG - Intergenic
1056150530 9:83782828-83782850 CTAAAAATACAAAGAGTAGGTGG - Intronic
1059202336 9:112429919-112429941 CCATATCTACAAAAAGTAGCAGG + Intronic
1061966984 9:134020501-134020523 CCATTTCTACAAAAAGTACCTGG - Intergenic
1062702642 9:137915769-137915791 CCATGACTACAAATGCTACGTGG - Intronic
1195292967 X:103446881-103446903 CCATCACTACACAGAGACCGAGG - Intergenic