ID: 1101587582

View in Genome Browser
Species Human (GRCh38)
Location 12:106098548-106098570
Sequence GCATTGTGATGTGCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101587582_1101587586 10 Left 1101587582 12:106098548-106098570 CCAGTTCCAGCACATCACAATGC 0: 1
1: 0
2: 2
3: 15
4: 127
Right 1101587586 12:106098581-106098603 TAAAGAGATGCAATCTTGCATGG 0: 1
1: 0
2: 1
3: 12
4: 178
1101587582_1101587587 18 Left 1101587582 12:106098548-106098570 CCAGTTCCAGCACATCACAATGC 0: 1
1: 0
2: 2
3: 15
4: 127
Right 1101587587 12:106098589-106098611 TGCAATCTTGCATGGCCAAGAGG 0: 1
1: 0
2: 3
3: 11
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101587582 Original CRISPR GCATTGTGATGTGCTGGAAC TGG (reversed) Intronic
900910606 1:5594498-5594520 GCTTTCTGATGAGCTGGAGCTGG - Intergenic
904576531 1:31508678-31508700 GCACTGTGATCTGCTGGAACGGG + Intergenic
905787633 1:40770717-40770739 GCATGGTGACTTGCTGGATCTGG - Exonic
906468710 1:46108770-46108792 GCTGTGTGATTTGATGGAACAGG - Intronic
906652468 1:47522423-47522445 GCTGTGTGAGGAGCTGGAACTGG + Intergenic
907939323 1:59072259-59072281 TCATTGTGATGGACTGGCACAGG + Intergenic
910151393 1:84151137-84151159 GTATTGTGGTGGTCTGGAACTGG - Intronic
911412548 1:97527950-97527972 TCATTGTGATATGCTACAACGGG + Intronic
912430553 1:109626364-109626386 GGAGCGTGATGTGCTGGAACGGG + Exonic
915669915 1:157479422-157479444 GCAATATGATGGGCTGGAAATGG + Intergenic
1064639442 10:17400550-17400572 GCTTTTTGATGTGCTGGATTTGG - Intronic
1067049349 10:43003260-43003282 GTCATGTGATGTCCTGGAACTGG - Intergenic
1067541817 10:47160437-47160459 GCATTAGGATGTGTTGGAAAGGG + Intergenic
1068782656 10:60938326-60938348 GCAGTGTTATGTAATGGAACTGG + Intronic
1069398044 10:68010859-68010881 GCTTTGAGATGTCCTGGGACTGG + Intronic
1070452834 10:76579176-76579198 TCATTGTTCTGTGTTGGAACAGG - Intergenic
1071898934 10:90097161-90097183 GCTTTGTGCTGTGATGTAACTGG - Intergenic
1074258517 10:111828411-111828433 GCATTCTCATGTGATGGAAAGGG - Intergenic
1077656724 11:4026814-4026836 ACACTCTGATGTGCTGGAAATGG - Intronic
1079196767 11:18335205-18335227 GCTTTCTGAGGTGATGGAACAGG - Intronic
1079931295 11:26565440-26565462 GCATTGGGATGTGCTGAGATGGG + Exonic
1080778716 11:35410684-35410706 GAATGGGGCTGTGCTGGAACGGG - Intronic
1090430033 11:126638105-126638127 GCATTGTAATGTGCTGGGAATGG + Intronic
1092676798 12:10929844-10929866 GTATTTTAATGTGCTGGGACGGG + Intronic
1098927081 12:76362302-76362324 GCTTTTTGATGTGCTGGATTCGG - Intronic
1101587582 12:106098548-106098570 GCATTGTGATGTGCTGGAACTGG - Intronic
1103550174 12:121731116-121731138 GCATGGTGAAGTTCTGGAAATGG + Intronic
1103744367 12:123111995-123112017 GCATTGTGGTGGGCTGGAGCGGG - Intronic
1106664092 13:31833542-31833564 GCATAGTGATATTCTGGAAGGGG - Intergenic
1110073826 13:71213617-71213639 ACAGTGTCATGTGCTGGAAAAGG - Intergenic
1113345400 13:109472764-109472786 GCCTTGTGCTGTGCTGGAGCTGG + Intergenic
1117344251 14:54817405-54817427 GGGTTGTGCTCTGCTGGAACTGG - Intergenic
1119688293 14:76650692-76650714 ACGTTGTGATGGGCTTGAACAGG + Intergenic
1121296945 14:92835032-92835054 GAATTGTGATGTCCTGAGACAGG + Intronic
1121746089 14:96294403-96294425 GCAGTGTGCTGTGCTCGAGCTGG + Intronic
1124689981 15:31813751-31813773 GCTTTGTGAAATGCTGAAACTGG - Intronic
1126091852 15:45059891-45059913 TTTTTGTGATGTGCTAGAACAGG + Intronic
1128080378 15:64853701-64853723 GGAGTGTGCTGTGCTGGAAAGGG + Intronic
1128919735 15:71599430-71599452 GCATTATGATGTGGATGAACAGG - Intronic
1129123015 15:73414366-73414388 GCAGTGTGAGGAGCTGGGACTGG + Intergenic
1129301518 15:74628334-74628356 GCATCGGGATGGGCTGGGACAGG + Intronic
1130047902 15:80460527-80460549 GCCTTGGGATGTGGTGGAGCGGG - Intronic
1131179043 15:90227926-90227948 TCACTGTGTTGGGCTGGAACTGG - Exonic
1132120467 15:99171083-99171105 GCACCGTGAAGTCCTGGAACAGG - Intronic
1133743547 16:8670078-8670100 GCATTTTGATGTGGTGGAAAGGG - Intergenic
1134448554 16:14348877-14348899 GCATTGTGGTGCCCTGGATCAGG - Intergenic
1136993438 16:35171291-35171313 GCATTGTGATCATATGGAACTGG + Intergenic
1143423291 17:6812896-6812918 GCAGTGTGATGTGGTGGACACGG - Exonic
1144317354 17:14075367-14075389 TCTTTGTGATGTGATGGAAAAGG + Intronic
1146318159 17:31825539-31825561 TTATTGTGATGTGGTGGACCTGG - Intergenic
1149593821 17:57851572-57851594 GCATTGTGAGGCACTGGAAAGGG - Intergenic
1151543646 17:74778476-74778498 GCATTGTGGTGTGATGGACAAGG + Intronic
1151842884 17:76630189-76630211 GCAGTGTGCTGTGCAGGCACTGG + Intronic
1153784410 18:8521908-8521930 GCATTATGATGTGCTAGAACTGG - Intergenic
1154149327 18:11893805-11893827 ACACTGTGGTGTGCAGGAACAGG + Intronic
1157113731 18:44844156-44844178 GCTTTTTGATGTGCTGCAAAAGG + Intronic
1162479914 19:10922033-10922055 GGCTTGTCATCTGCTGGAACAGG + Exonic
1163135388 19:15307597-15307619 GCATTGTCTTGTCCTGGAAAGGG - Intronic
1164388580 19:27796770-27796792 GCATTGTGATCATATGGAACTGG + Intergenic
1167089125 19:47331331-47331353 CCACTGTGATATGCTGGAAGAGG + Intergenic
1168109878 19:54186381-54186403 GGATTGAGATCTGCTGGAAGAGG - Intronic
926020904 2:9495042-9495064 GCATTGTGAGGGGCTTGAAGGGG - Intronic
931215935 2:60244801-60244823 GAATTGTAAAGTGCTGGAACAGG + Intergenic
936596030 2:113848870-113848892 GACCTGTGATGTGCTGGAGCTGG + Intergenic
937159461 2:119746538-119746560 AGATAGAGATGTGCTGGAACGGG + Intergenic
946504127 2:220280906-220280928 ACTCTGTGAGGTGCTGGAACAGG + Intergenic
946634789 2:221712735-221712757 GAATTGAGATGTGCTGTAAGTGG + Intergenic
947963380 2:234258804-234258826 GCAGTGAGATGTGCGGAAACAGG + Intergenic
947983317 2:234427907-234427929 GCATAGTGATGTGGTGAAAATGG - Intergenic
1177748344 21:25249802-25249824 ACATTGTGATGTTCTGGAGTAGG + Intergenic
1179464719 21:41563797-41563819 GCATTGGGATGTCCTGCAAATGG + Intergenic
1183610197 22:38896863-38896885 GCTTTATGATGTGATGAAACAGG - Intergenic
950350169 3:12342094-12342116 GCCTTCTGATGTGATGGAATAGG + Intronic
952376698 3:32773560-32773582 GCATTTGGATGGGCTGGATCGGG - Exonic
953716827 3:45322808-45322830 GCATTGTGGTGTGAGGGAAGGGG + Intergenic
954756233 3:52841692-52841714 GCATTGGGATGTGCTCGTACAGG - Intronic
956057899 3:65320129-65320151 GTACAGTGATGTGCTGGAGCTGG - Intergenic
961471623 3:127116946-127116968 ACATTGTGTTCTGCAGGAACTGG + Intergenic
965552429 3:169981440-169981462 GTGCTGTGATGTGCTGGAGCAGG + Intronic
965608872 3:170524145-170524167 GCCTAGTGATGTGCTGGTAAAGG + Intronic
965653026 3:170953353-170953375 TCATTGTGTTGAGCTGGACCTGG + Intergenic
968115588 3:196086916-196086938 GTACTGTTATGTGCTGGAAAAGG + Intergenic
969153515 4:5190469-5190491 GCAGTGTGGTGTCCTGGCACAGG - Intronic
969515117 4:7643117-7643139 GCATTGTAAAGTCATGGAACAGG - Intronic
970140081 4:12972671-12972693 GCATTGTGAATTGTTGTAACTGG + Intergenic
970909323 4:21256091-21256113 GCAGTGAGATGTGCTAGAAGTGG + Intronic
976059777 4:81113587-81113609 GCATTGTGGCTTGCTGGAGCTGG + Intronic
978467367 4:109022591-109022613 GCATTTTCAAGTGTTGGAACTGG - Intronic
980011698 4:127602537-127602559 GCCTTGGGAAGTGCAGGAACAGG - Intergenic
981003990 4:139856135-139856157 GCATTGTGCTGGGTAGGAACAGG - Intronic
981658143 4:147135621-147135643 GCATTGTGAAGCTCTGGAAGGGG - Intergenic
983677496 4:170312782-170312804 CCATTGTGAAATGCTGGAAAAGG + Intergenic
983797219 4:171879766-171879788 GTATTGTCATGAGCTGAAACAGG - Intronic
992665878 5:79008621-79008643 GGGTTGAGATGTGCTGGAAAAGG + Intronic
993374029 5:87127982-87128004 ATATTATGATATGCTGGAACTGG - Intergenic
993596692 5:89865158-89865180 GGAATGGAATGTGCTGGAACTGG - Intergenic
994673533 5:102792580-102792602 GCATTGTGAAGAGTTGGAATGGG + Intronic
994846059 5:104989814-104989836 GCTGTGTGATTTGCTGAAACAGG + Intergenic
1000273819 5:159713995-159714017 GCCCTGTGATGTGATGCAACAGG - Intergenic
1001384291 5:171325566-171325588 GAATTGTTCTGTCCTGGAACAGG + Intergenic
1003569757 6:7248086-7248108 GCATTGCGATGTGGTGCAGCGGG - Intronic
1003876353 6:10441104-10441126 GGATTGTGTTGTGCTTGGACTGG + Intergenic
1005984994 6:30866175-30866197 TTATTGTGATGAACTGGAACTGG - Intergenic
1007171371 6:39865651-39865673 GCCCCGTGGTGTGCTGGAACTGG + Intronic
1007528745 6:42521463-42521485 GCATTGTGATGGGGTGGGGCTGG + Intergenic
1007627394 6:43254212-43254234 GCAATGTGATTTGGTGTAACTGG - Intronic
1016944500 6:149516346-149516368 GCATTGTGAGGTGTTAGAACTGG - Intronic
1017887359 6:158610150-158610172 ACCTTGTGATGTTCTGGGACAGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022773431 7:33499391-33499413 GCAATAGGCTGTGCTGGAACAGG - Intronic
1025639270 7:63352035-63352057 GCATTGTGGTCAGATGGAACTGG - Intergenic
1025643429 7:63396057-63396079 GCATTGTGGTCAGATGGAACTGG + Intergenic
1028323548 7:89493388-89493410 ACATTGTGATGTACTGTAAAAGG - Intergenic
1031219081 7:118940541-118940563 GCATGGTGATGTGTAGGAAGGGG + Intergenic
1032648256 7:133849623-133849645 GAATAGTGATGTGCTGGAGCTGG - Intronic
1034034936 7:147809236-147809258 GCATTAGTATGTGCTGAAACTGG - Intronic
1034133545 7:148743254-148743276 AGATGGTGATGTGCTGGAGCTGG + Intronic
1034908564 7:154973051-154973073 GCATTGGGCGGTGCTGGAGCTGG + Intronic
1038203050 8:25434022-25434044 GCATTGTGATGTGCCTGCTCAGG - Intronic
1038511406 8:28139358-28139380 GCACTGTGGTGTTTTGGAACAGG + Intronic
1040484702 8:47858944-47858966 GCATGATGATGTGCTGGAGCTGG - Exonic
1040564597 8:48554338-48554360 GCACTGAGAGGAGCTGGAACAGG + Intergenic
1041385142 8:57293299-57293321 GCTTTTTGATGTGCTGGATTCGG + Intergenic
1041723991 8:61001419-61001441 ACATTGAGATGTGCTGTAACTGG - Intergenic
1043315475 8:78916270-78916292 GCAATGTGATATCCTGGAAAAGG + Intergenic
1045265895 8:100618440-100618462 CCATTGTGATGTTCAAGAACTGG - Intronic
1046243257 8:111526587-111526609 GCAATGGGGTGTACTGGAACAGG + Intergenic
1046344705 8:112907428-112907450 GCTTTTATATGTGCTGGAACTGG - Intronic
1046850214 8:118963877-118963899 GCTTTGTGAGGTGCTGGACATGG + Intergenic
1047754710 8:127909689-127909711 GCATGGGGATGTGGTGGTACAGG + Intergenic
1052372725 9:27683892-27683914 GCATTGTGATTTGCTGAGACAGG + Intergenic
1058897653 9:109413963-109413985 AAATTGTGGTGTGATGGAACAGG + Intronic
1059093043 9:111382080-111382102 GCATGGTGATGTGATGGAATAGG - Intronic
1059676628 9:116546617-116546639 GCATTTTGATATGATGGTACAGG - Intronic
1061686433 9:132283942-132283964 GCAGTGTGCTGTGATGGAGCCGG + Intronic
1186079262 X:5912808-5912830 GCTCTGTGATGTGATGGAGCAGG + Intronic
1188771916 X:34163210-34163232 GAATTGTGATCTACTGGGACCGG + Intergenic
1188797556 X:34484289-34484311 GAATTGTGATCTACTGGGACTGG + Intergenic
1192366480 X:70477891-70477913 GGAGTGTCAGGTGCTGGAACAGG + Intronic
1194196210 X:90895729-90895751 GCATTGTCATGTGTTGGCACTGG - Intergenic
1195135817 X:101906593-101906615 GCACTGTGGTCTACTGGAACTGG - Intronic
1198375888 X:136039751-136039773 GCAATGTGATGTAGTGGAAAGGG + Intronic
1198575911 X:138010043-138010065 TCATTGAGATGTGCTGTAAGTGG - Intergenic
1199295216 X:146149434-146149456 GCACTGTGATGTGATAGTACAGG - Intergenic
1200542054 Y:4469921-4469943 GCATTGTCATGTGTTGGCACTGG - Intergenic