ID: 1101589214

View in Genome Browser
Species Human (GRCh38)
Location 12:106111364-106111386
Sequence ATAAGACACCAGGACACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101589214_1101589225 21 Left 1101589214 12:106111364-106111386 CCCAGGGTGTCCTGGTGTCTTAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1101589225 12:106111408-106111430 TAGGACCAGCCTTGGGGGCGTGG 0: 1
1: 0
2: 2
3: 26
4: 203
1101589214_1101589221 13 Left 1101589214 12:106111364-106111386 CCCAGGGTGTCCTGGTGTCTTAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1101589221 12:106111400-106111422 GTGTAGTGTAGGACCAGCCTTGG 0: 1
1: 0
2: 0
3: 13
4: 318
1101589214_1101589223 15 Left 1101589214 12:106111364-106111386 CCCAGGGTGTCCTGGTGTCTTAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1101589223 12:106111402-106111424 GTAGTGTAGGACCAGCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1101589214_1101589224 16 Left 1101589214 12:106111364-106111386 CCCAGGGTGTCCTGGTGTCTTAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1101589224 12:106111403-106111425 TAGTGTAGGACCAGCCTTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1101589214_1101589219 2 Left 1101589214 12:106111364-106111386 CCCAGGGTGTCCTGGTGTCTTAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1101589219 12:106111389-106111411 AGAGGACGCCTGTGTAGTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 93
1101589214_1101589222 14 Left 1101589214 12:106111364-106111386 CCCAGGGTGTCCTGGTGTCTTAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1101589222 12:106111401-106111423 TGTAGTGTAGGACCAGCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101589214 Original CRISPR ATAAGACACCAGGACACCCT GGG (reversed) Intronic
904220231 1:28961347-28961369 GTAATAAACCAGGACACTCTCGG - Intronic
904373040 1:30062732-30062754 ATAAGACACCAGGTTAGCCGGGG + Intergenic
904849125 1:33443902-33443924 AGAGGACACCAGGTCATCCTCGG + Intergenic
912555632 1:110514074-110514096 ATCAGACCCCAGGACAGGCTGGG - Intergenic
914321544 1:146567219-146567241 ATAACACACCATCACACCTTTGG - Intergenic
915048461 1:153040802-153040824 AAAAGACACCAGGAAAACATGGG + Intronic
916485728 1:165256909-165256931 ACAACACACCGAGACACCCTAGG + Intronic
917978753 1:180256460-180256482 ATGAGACAGCAGGTCAGCCTGGG + Intronic
918937941 1:190948660-190948682 CTAAGACACAAGCACACACTAGG - Intergenic
920789442 1:209075316-209075338 ATAAAACACCAGGAAAGACTGGG + Intergenic
922445158 1:225690832-225690854 ATAAGACACCAAGACAAACAGGG + Intergenic
922884062 1:229004567-229004589 AATAGACATCGGGACACCCTTGG + Intergenic
923510677 1:234649700-234649722 TTTAGACTCCAGGACACCCTGGG - Intergenic
1063626996 10:7699536-7699558 AGAAAACACCCAGACACCCTGGG + Intergenic
1064107029 10:12508891-12508913 ATAAGCCACAAGGACACTCCTGG + Intronic
1064310177 10:14205476-14205498 CTAAGAAACCAGGATTCCCTGGG + Intronic
1066619470 10:37329788-37329810 ATAAGACATCATGACAACGTAGG + Intronic
1066651810 10:37663339-37663361 GGAAGACAGCAGGACATCCTTGG - Intergenic
1070700828 10:78600510-78600532 ATATAACACCAGGACTCCCAGGG - Intergenic
1072627383 10:97121624-97121646 ATCACACACCAGAAAACCCTCGG + Intronic
1074147895 10:110732858-110732880 AACAGACCCCAGGAAACCCTAGG + Intronic
1077905708 11:6531409-6531431 ATAAAATACCAGGACTCCTTGGG - Intronic
1081876755 11:46413849-46413871 AGAAGACACCAGGACATGTTGGG - Intronic
1082954724 11:58857610-58857632 ATAAGACATCAACACAACCTGGG - Intronic
1082971782 11:59030307-59030329 ATAAGACATCAACACAACCTAGG - Intronic
1087173022 11:95069809-95069831 ATAAAAAATCAGGACACCCATGG + Exonic
1091395655 12:152919-152941 AGATGACTCCAGGCCACCCTGGG + Intronic
1096157526 12:49348877-49348899 ATAGGTCACCAGGAGCCCCTTGG - Exonic
1101032461 12:100673849-100673871 ATAAGACACTAGGTCAGGCTAGG + Intergenic
1101070808 12:101073700-101073722 TTCAGATACCAGGACACTCTTGG - Intronic
1101589214 12:106111364-106111386 ATAAGACACCAGGACACCCTGGG - Intronic
1103905049 12:124322853-124322875 AAAACACACCAGGACATCCCCGG + Intergenic
1104627203 12:130367420-130367442 TTCAGACACCAGGAAACCATGGG - Intronic
1108793425 13:54001152-54001174 AAAAGACTCCATGCCACCCTTGG + Intergenic
1117673309 14:58129947-58129969 CTAAAACCCCAGGACACCTTAGG + Intronic
1119207984 14:72809073-72809095 TTAAAACACCAGGGCCCCCTTGG + Intronic
1119786993 14:77321217-77321239 GTTAGACACCTGGAGACCCTGGG + Intronic
1120189124 14:81423864-81423886 ACAAGGAACCAGGACACACTGGG + Intronic
1122255513 14:100472950-100472972 AAAAGACACTGGGACACCCAGGG - Intronic
1122391844 14:101394737-101394759 ATAAGACCCCAGGACAACAGTGG + Intergenic
1124832277 15:33160777-33160799 AGAAGACACGAAGACTCCCTGGG - Intronic
1125730561 15:41890594-41890616 TGAAGATCCCAGGACACCCTGGG - Intronic
1128434952 15:67637621-67637643 TGAAGACTCCAGGACCCCCTCGG + Intronic
1130088131 15:80795571-80795593 ATTATACTCCAGGACACACTGGG + Intronic
1130318354 15:82816488-82816510 GTAAGACAAAAGGACACTCTGGG - Intronic
1136858356 16:33679436-33679458 CCAAGACACCAGGAAGCCCTGGG - Intergenic
1137832333 16:51555766-51555788 TTGAGACACCACAACACCCTAGG - Intergenic
1138960411 16:62022627-62022649 ATAAGTTCTCAGGACACCCTCGG + Intronic
1140012085 16:71143924-71143946 ATAACACACCATCACACCTTTGG + Intronic
1141504545 16:84466473-84466495 ATAAGACACCAGGACGAAGTGGG + Intergenic
1203119925 16_KI270728v1_random:1527906-1527928 CCAAGACACCAGGAAGCCCTGGG - Intergenic
1142730375 17:1850611-1850633 ATGAGCCACCAGCACAGCCTAGG - Intronic
1144532078 17:16049303-16049325 ATCAGACACCATCTCACCCTTGG + Intronic
1149228886 17:54508924-54508946 TCAAAACACCAGGTCACCCTTGG + Intergenic
1149322862 17:55499118-55499140 AAAAGACACCAGGACAGAGTTGG - Intergenic
1152876707 17:82790488-82790510 CAAAGACACCAGGACACACGGGG - Intronic
1156078223 18:33305940-33305962 AGAAGACACCAGGGATCCCTGGG + Intronic
1163282344 19:16325400-16325422 CTCAGACACCAGGCCACCCGCGG - Exonic
1163303008 19:16459570-16459592 ACAAGCCACCAAGCCACCCTGGG + Intronic
925168690 2:1737169-1737191 ACAAGACACCAGAACACCCAAGG + Intronic
926061705 2:9808711-9808733 TGAGGACACCAAGACACCCTGGG + Intergenic
926158752 2:10473509-10473531 ATGAGTCCTCAGGACACCCTGGG - Intergenic
931068407 2:58614999-58615021 ATAATACACCAAGACACTCTTGG - Intergenic
931398292 2:61907645-61907667 ATAAAACAGCAGGATACCCAGGG + Intronic
932943328 2:76195798-76195820 ATAAGACAGCAAGACAACCTGGG - Intergenic
938887959 2:135672813-135672835 ATAAGATACCAGGCCAGCCACGG + Intronic
940540361 2:155008639-155008661 ACAAAACACCATGACACCATGGG + Intergenic
942465784 2:176206208-176206230 TTAAGAAAGCAGGAGACCCTGGG + Intergenic
942558033 2:177191638-177191660 CTAAGAGACCAGGACACTCTGGG - Intergenic
943606627 2:189984264-189984286 ATAAGACACAGGTACACCCTGGG + Intronic
944485415 2:200200051-200200073 ATATGTAACCAGGCCACCCTAGG + Intergenic
946095575 2:217271440-217271462 GTAAGACACTAAGAGACCCTAGG + Intergenic
948427003 2:237894718-237894740 AAAAGCCACCTGGACAGCCTGGG - Intronic
1171411436 20:24950942-24950964 ATTAGATCCCAGGACACGCTAGG - Intronic
1174405176 20:50298284-50298306 AAAAGACACAAGGACACCCTTGG - Intergenic
1175348503 20:58300919-58300941 TTAAGAAACCAGGAGACCCTTGG - Intergenic
1175643004 20:60647220-60647242 ATAAGATACCCGGAAATCCTTGG + Intergenic
1179626086 21:42650344-42650366 TTAGGATACCAGGAGACCCTGGG + Intergenic
1179843162 21:44090646-44090668 GTAGGACACCTGGACACCGTGGG - Intronic
1184333218 22:43838949-43838971 ATAAGACACCACCAGATCCTTGG + Exonic
1184722375 22:46322427-46322449 CTCAGGCACCAGGACCCCCTTGG - Intronic
1184968908 22:48001402-48001424 ATAAGACACCAGGATGTCTTGGG - Intergenic
953506990 3:43496061-43496083 ATAAGTTACCAGGACACTTTTGG + Intronic
954137037 3:48586672-48586694 GTAAGACAGCAGGCCAACCTGGG + Exonic
955006793 3:54976159-54976181 AAAAGACAGCAGGACACAGTAGG - Intronic
955208297 3:56917387-56917409 AGAAGGCCCCAGGAAACCCTGGG - Intronic
956210960 3:66800858-66800880 CTAAGACACAAACACACCCTAGG - Intergenic
959778380 3:110199135-110199157 ATGGGTCACCAGGACACCCAAGG - Intergenic
959973110 3:112428873-112428895 TTAAGATTCCAGGACACACTGGG - Intergenic
965486495 3:169284868-169284890 ATAAGACACCAGTACTTCCATGG + Intronic
969222949 4:5773249-5773271 ACAAGACACCGGGAAACCCAGGG + Intronic
971378392 4:26073971-26073993 ATGGGCCACCAGGAAACCCTGGG + Intergenic
974284949 4:59853091-59853113 ATAAGACACCAAGACTTCATAGG + Intergenic
975131479 4:70837062-70837084 ACAAGACAGCAGGACGCCTTGGG + Intronic
975461079 4:74654067-74654089 ATAAGCCACCAGGTAATCCTAGG - Intergenic
977301672 4:95274504-95274526 ATAAGAAAACAGGGGACCCTAGG - Intronic
980072285 4:128256348-128256370 ACAAAACACCTGGGCACCCTAGG + Intergenic
981624313 4:146738542-146738564 ATAAGACCACAGGACACCTCTGG - Intronic
983540684 4:168906428-168906450 TTAAGACAGCAGGCCAGCCTTGG + Intronic
983986361 4:174064838-174064860 AGAAGTAACCAGAACACCCTGGG - Intergenic
1001292415 5:170473282-170473304 ATATGACAACATGACATCCTTGG - Intronic
1001536721 5:172503267-172503289 GGATGACACCAGGACAACCTTGG + Intergenic
1004035750 6:11921122-11921144 CTGACACACCAGGACACCCAGGG - Intergenic
1014601801 6:123422166-123422188 ATAAGAGACCTGAACATCCTTGG + Intronic
1019587190 7:1812001-1812023 AAATGTCACCAGGACACCATGGG - Intergenic
1024938699 7:54739883-54739905 ACAAGGCACCGGGACACACTAGG + Intergenic
1025777841 7:64574811-64574833 CTAAGATGCCAGGACCCCCTGGG + Intergenic
1025998078 7:66541127-66541149 CTGAGACACCAGGAAACCCAGGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033591761 7:142814402-142814424 GGAGGACACCAGCACACCCTTGG + Intergenic
1035784885 8:2252605-2252627 TTAAGATTCGAGGACACCCTTGG + Intergenic
1035807923 8:2469116-2469138 TTAAGATTCGAGGACACCCTTGG - Intergenic
1041033852 8:53766677-53766699 ATAAGAGACAGGTACACCCTGGG - Intronic
1041136501 8:54764602-54764624 ATAAGACATCAGCCCAACCTTGG - Intergenic
1044306753 8:90647403-90647425 ATAACGGACCAGGACACCTTAGG + Intronic
1048073937 8:131048346-131048368 GTAAGAGAACAGGACACCTTTGG - Intergenic
1048555106 8:135468315-135468337 AAAAGAAACCAGGGCACCTTTGG - Intronic
1048809241 8:138270200-138270222 ATAAGAAACCAGGAACTCCTGGG + Intronic
1051608531 9:18939682-18939704 AGAAGACACCAGGACTTCCAAGG + Intronic
1059573787 9:115468434-115468456 ACAAGAATTCAGGACACCCTGGG - Intergenic
1059862390 9:118479273-118479295 ATAAGGCAACAGGACACCAAAGG - Intergenic
1189358351 X:40328432-40328454 AAAAGAAACAAGGACACTCTGGG + Intergenic
1196059139 X:111388849-111388871 ATAAGACAAGAGCACACACTTGG + Intronic
1197347389 X:125340822-125340844 ATAGGACACAAGGACTCCCAGGG - Intergenic
1199239714 X:145532066-145532088 ATAAGACTGAAAGACACCCTGGG - Intergenic