ID: 1101589700

View in Genome Browser
Species Human (GRCh38)
Location 12:106114699-106114721
Sequence AGGGATAAACACTCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 3, 2: 2, 3: 14, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101589696_1101589700 -5 Left 1101589696 12:106114681-106114703 CCTGATTCCCACTCCAGGAGGGA 0: 1
1: 0
2: 0
3: 25
4: 235
Right 1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG 0: 1
1: 3
2: 2
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101589700 Original CRISPR AGGGATAAACACTCTGAGCA AGG Intronic
905187585 1:36207611-36207633 AGGAGTAAACACTCGCAGCAAGG + Intergenic
907037781 1:51231572-51231594 AGGTATAAATACTCTCACCATGG + Intergenic
907275044 1:53312266-53312288 AGGGCCAAACATTCTGAGTAGGG - Intronic
907563275 1:55410760-55410782 AGTGATATAAACTCTGTGCATGG + Intergenic
908386244 1:63644334-63644356 AAGGTAAAACACTCTGGGCAAGG - Intronic
909255307 1:73413315-73413337 AGGTATTAAGATTCTGAGCATGG + Intergenic
909551702 1:76905206-76905228 AGGGGTAGAGACTCTGAGAAAGG + Intronic
910390296 1:86736019-86736041 AGGGATGAATATTCTAAGCAAGG + Intronic
911218760 1:95224745-95224767 AGTGATATACAGTCTGGGCATGG + Intronic
912392286 1:109311814-109311836 AGTGCTAACCACTTTGAGCAAGG - Exonic
913165161 1:116178395-116178417 GGGGAAACAAACTCTGAGCAGGG - Intergenic
915734376 1:158075434-158075456 AAGGATGAACACACAGAGCAGGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921663945 1:217844113-217844135 AGGGATAAAATCTCTGACCTAGG - Intronic
923998809 1:239527684-239527706 AGTGATGAACACTGTGATCAAGG - Intronic
1064974525 10:21099718-21099740 AGGGAGAAAGACTGTGAGCCAGG + Intronic
1069400138 10:68035616-68035638 TGGGATAAACACTTTAAACAAGG + Intronic
1069847565 10:71383255-71383277 AGGGAGCAAGACTCTGAGCTGGG + Intergenic
1070172210 10:73941317-73941339 AGGGATAAAGACCATGAGGACGG - Intergenic
1070280736 10:75046434-75046456 AGGGACCAACACCCTGAGCCAGG + Intronic
1070993477 10:80753905-80753927 TGGTATAAACACTCCCAGCATGG + Intergenic
1073697187 10:105882863-105882885 AGGGAAAAAAACTCCAAGCAAGG + Intergenic
1074584558 10:114754732-114754754 AGTGATAAACACTAAGAGAAGGG - Intergenic
1075144124 10:119868925-119868947 AGTGATAAAGTCTCAGAGCAAGG + Intronic
1079170588 11:18091440-18091462 AGGAATAAATACTCTGAACTAGG + Intronic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1089395951 11:118136398-118136420 GGGCTTAAAAACTCTGAGCAGGG + Exonic
1094117662 12:26935048-26935070 AGGGATAGACAATCTGGGTACGG + Intronic
1095443568 12:42261738-42261760 AGTGATAAATACTTTGAGAAGGG - Intronic
1098495057 12:71124238-71124260 TGGCATAAATACTCCGAGCATGG + Intergenic
1098688517 12:73456764-73456786 ATGGTTAAGGACTCTGAGCATGG + Intergenic
1099335824 12:81355842-81355864 AGTGATAAACAATCAAAGCATGG - Intronic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1104406439 12:128521193-128521215 AGAGATAATCACTTTGAGGATGG - Intronic
1104807654 12:131599767-131599789 AGGGAAGGACACTCTGAGCAGGG - Intergenic
1107318070 13:39155628-39155650 AGGGAATAACTCTCTAAGCAGGG - Intergenic
1108271068 13:48760045-48760067 AGGGATAAGAGCTCTCAGCATGG - Intergenic
1109435511 13:62294353-62294375 AGGGATGAACAAGCTGGGCAGGG - Intergenic
1114015146 14:18421611-18421633 AGGGACAAACACTCAGAACCTGG + Intergenic
1114019927 14:18468963-18468985 AGGGAGAAACACTCAGAACCAGG + Intergenic
1114020515 14:18474176-18474198 AGGGACAAACACTGAGAACACGG + Intergenic
1114022876 14:18496757-18496779 AGGGACAAACACTCAGAACTCGG - Intergenic
1114026085 14:18528045-18528067 AGGGACAAACACTCAGAAAATGG - Intergenic
1114026958 14:18536601-18536623 AGGGACAAACACTGAGAACACGG - Intergenic
1115455178 14:33593766-33593788 AGTTGTAAAAACTCTGAGCAAGG - Intronic
1118888567 14:69887779-69887801 AGGGTGAATCACCCTGAGCAAGG - Intronic
1118931009 14:70240408-70240430 AGTGGTAAACTCTCAGAGCATGG - Intergenic
1121478409 14:94236936-94236958 AATGACAAACACTCTGATCAAGG - Intronic
1121683445 14:95813863-95813885 AGGGATCATCATTCTGAGTATGG - Intergenic
1121827258 14:97020612-97020634 AGGGATAAGCACCCAGAGCCTGG + Intergenic
1121986393 14:98510544-98510566 AGGAAGAAAAACTCTGAGAAAGG + Intergenic
1202837922 14_GL000009v2_random:92107-92129 AGGGACAAACATTCAGACCACGG - Intergenic
1202837935 14_GL000009v2_random:92203-92225 AGGGACAAACATTCAGACCACGG - Intergenic
1202907286 14_GL000194v1_random:82123-82145 AGGGACAAACATTCAGACCACGG - Intergenic
1202907293 14_GL000194v1_random:82171-82193 AGGGACAAACATTCAGACCACGG - Intergenic
1202885502 14_KI270722v1_random:103242-103264 AGGGACAAACATTCAGACCATGG + Intergenic
1202885704 14_KI270722v1_random:105104-105126 AGGGACAAACATTCAGACCACGG + Intergenic
1202888048 14_KI270722v1_random:127214-127236 AGGGACAAACATTCAGACCATGG + Intergenic
1123764078 15:23457509-23457531 AGAGATAAACTATCTGAGAAAGG + Intergenic
1123891202 15:24781355-24781377 AAGGATATACACTATGACCAAGG - Intergenic
1125701087 15:41684528-41684550 AGTTATAAACACTCTCAGAAAGG - Intronic
1126785709 15:52176498-52176520 AGGGACAAACACACTTAGGAAGG + Intronic
1129524405 15:76204672-76204694 AGGGAACAGCACTGTGAGCAGGG + Exonic
1129635458 15:77311969-77311991 AGGGATGAACACTGGGAGTAGGG + Intronic
1129688079 15:77697634-77697656 GGGTACAAACACCCTGAGCAGGG + Intronic
1130031285 15:80316824-80316846 AGGGAGAAACACCCAGAGCCCGG - Intergenic
1131320820 15:91388917-91388939 ACTGATAAACAGTCTGGGCATGG - Intergenic
1133116774 16:3582069-3582091 AGGGAGACACACTGTGAGCACGG + Exonic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1136170898 16:28488701-28488723 AGGGATAGACACACAGAGCCTGG + Intronic
1137627084 16:49916092-49916114 AGGGATAAACAACATTAGCAGGG - Intergenic
1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG + Intergenic
1141330186 16:83103676-83103698 AAGGTTAAACACTCTGCTCAAGG - Intronic
1146064988 17:29627540-29627562 AGGGATAAAGACACAGAACAAGG + Exonic
1146895306 17:36536468-36536490 TGGGATATAAACTCTGAGAATGG - Intronic
1148643681 17:49206724-49206746 AGGGACAGACACTCAGGGCAGGG + Exonic
1203156510 17_GL000205v2_random:9030-9052 AGGGAGAAACACTCAGAACCCGG + Intergenic
1155319014 18:24600064-24600086 AGGGATACATATTCTAAGCATGG + Intergenic
1155386055 18:25278622-25278644 AAAGATAAACAACCTGAGCAAGG - Intronic
1157375079 18:47155770-47155792 AGGGATAACCACTCACATCATGG + Intronic
1158448940 18:57546395-57546417 AGTCATCTACACTCTGAGCAGGG + Intergenic
1161376332 19:3940957-3940979 AGGGACAGAACCTCTGAGCAAGG - Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1165152555 19:33769623-33769645 AGGGAAATAGACTCTGGGCATGG + Intronic
1202634669 1_KI270706v1_random:34700-34722 AGGGACAAACATTCAGACCACGG + Intergenic
1202650490 1_KI270706v1_random:174878-174900 AGGGACAAACATTCAGACCATGG - Intergenic
1202650810 1_KI270707v1_random:1823-1845 AGGGACAAACATTCAGACCATGG - Intergenic
1202660905 1_KI270708v1_random:70268-70290 AGGGACAAACATTCAGACCATGG + Intergenic
1202661105 1_KI270708v1_random:72081-72103 AGGGACAAACATTCAGACCACGG + Intergenic
1202663446 1_KI270708v1_random:94009-94031 AGGGACAAACATTCAGACCATGG + Intergenic
927325826 2:21803802-21803824 AGGGAAAAATACTTTGAACATGG + Intergenic
927433848 2:23049978-23050000 ATTAAAAAACACTCTGAGCAGGG - Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
929046915 2:37799108-37799130 AGGGAGAAGCAATCTAAGCATGG - Intergenic
935633296 2:105230207-105230229 AGGGATGAACAGGCAGAGCATGG + Intergenic
936339346 2:111617587-111617609 AGGGAAAAAGTCTCTGAGCAGGG + Intergenic
936848357 2:116865955-116865977 AGGGATAGACAGTCTGAGCTGGG + Intergenic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
941587228 2:167375701-167375723 ACTGATAAACACTTTTAGCAAGG - Intergenic
941754581 2:169171326-169171348 AGTGATATACACTCTGGGCAGGG + Intronic
942384549 2:175427922-175427944 TGGGATAAACCCTATGATCATGG - Intergenic
943607236 2:189990480-189990502 AGGACTATACACTCTGACCAAGG - Intronic
943638150 2:190328517-190328539 TTGAATCAACACTCTGAGCATGG - Intronic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1173316546 20:41950043-41950065 AGGCACAGACATTCTGAGCATGG + Intergenic
1173859401 20:46272715-46272737 AGACATCAACACTCTTAGCAAGG - Intronic
1175395429 20:58655766-58655788 AAGCATAACCACTCTGAGCCGGG - Intronic
1176601320 21:8797687-8797709 AGGGACAAACATTCAGACCACGG + Intergenic
1176646882 21:9360421-9360443 AGGGACAAACATTCAGACCACGG + Intergenic
1180328390 22:11453864-11453886 AGGGACAAACATTCAGACCATGG + Intergenic
1180328575 22:11455438-11455460 AGGGACAAACATTCAGACCACGG + Intergenic
1180330188 22:11470938-11470960 AGGGACAAACATTCAGACCATGG + Intergenic
1180343605 22:11689224-11689246 AGGGACAAACATTCAGACCACGG + Intergenic
1180366038 22:11938528-11938550 AGGGACAAACATTCAGACCATGG - Intergenic
1180417159 22:12777859-12777881 AGGGACAAACATTCAGACCACGG - Intergenic
1180439647 22:15352388-15352410 AGGGACAAACACTCAGAACCTGG + Intergenic
1180444434 22:15399788-15399810 AGGGAGAAACACTCAGATCCAGG + Intergenic
1180445022 22:15405001-15405023 AGGGACAAACACTGAGAACACGG + Intergenic
1180446979 22:15423713-15423735 AGGGACAAACACTCAGAACTCGG - Intergenic
1180450206 22:15455098-15455120 AGGGACAAACACTCAGAAAATGG - Intergenic
1180451094 22:15463796-15463818 AGGGACAAACACTCAGAACACGG - Intergenic
1180678257 22:17603901-17603923 AGGGATAGACAGCCTGAGTATGG + Intronic
1182121749 22:27791741-27791763 AGAGATAAACACTCTTGGTAAGG - Intronic
1182950797 22:34373856-34373878 AAGGAAAAACACTCAGAGCATGG + Intergenic
1183595967 22:38811915-38811937 TGGGTTACACACTCTGAGTAGGG - Intergenic
949185144 3:1181681-1181703 AGGGATAAACCCTATGTGCAGGG - Intronic
949262873 3:2122469-2122491 AGGAATAAATACTCTTCGCAGGG - Intronic
950311911 3:11966260-11966282 TGGGATAAATATTCTGACCATGG + Intergenic
952214307 3:31261056-31261078 AGGGATACAGACTCAGAGTAAGG + Intergenic
952261075 3:31741057-31741079 AGGTCTCAACACTCTAAGCAAGG - Intronic
952701902 3:36337149-36337171 AGGGAAAAACATTCTCTGCATGG - Intergenic
954539308 3:51383142-51383164 AGAGAAAAACACACTGACCATGG - Exonic
956101591 3:65773779-65773801 AGGCATAAACACTCGAATCAAGG - Intronic
957971171 3:87384519-87384541 AGGGATAAATAGGCAGAGCACGG - Intergenic
958651801 3:96945975-96945997 AGGGATGAACAAGCAGAGCATGG - Intronic
959365328 3:105451106-105451128 AGGAAAAAAAAATCTGAGCATGG + Intronic
961484004 3:127204907-127204929 TGGGGTTAACAGTCTGAGCAGGG - Intergenic
961934115 3:130565166-130565188 AGTGATAAATTCACTGAGCATGG + Exonic
962789460 3:138798024-138798046 AGTGAAAAACACACTGTGCAAGG + Intronic
964846929 3:161054402-161054424 CGGGATAAAGCCTCTAAGCAGGG + Intronic
967050146 3:185775597-185775619 AGGGAACATCATTCTGAGCAAGG + Intronic
967554735 3:190842521-190842543 AGGGATAGAGACTCTGAGAGTGG - Intergenic
1202739938 3_GL000221v1_random:43996-44018 AGGGACAAACATTCAGACCACGG - Intergenic
1202740000 3_GL000221v1_random:44571-44593 AGGGACAAACATTCAGACCACGG - Intergenic
968837182 4:2973608-2973630 AGGGCTGAACACTCTGTCCAAGG - Intronic
969845766 4:9918868-9918890 AGGGCAGAACACTCTGAGGATGG + Intronic
970015234 4:11505661-11505683 TGTGATAAATACTCTGAACAAGG - Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
972555106 4:40173577-40173599 AGGGAAATACGCTCTGTGCAAGG + Intergenic
973364643 4:49199479-49199501 AGGGACAAACATTCAGACCACGG + Intergenic
973395947 4:49592971-49592993 AGGGACAAACATTCAGACCACGG - Intergenic
973396267 4:49595784-49595806 AGGGACAAACATTCAGACCACGG - Intergenic
973922652 4:55704539-55704561 AGGGAGGAACATTCTGAGCAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978679131 4:111356916-111356938 AGGGATACACCCTCTGACGAGGG + Intergenic
978987241 4:115028288-115028310 CAGGATAAACACTCTTAACAAGG + Intronic
979124810 4:116956019-116956041 AGGGAAAAACTCTATGAGTAGGG + Intergenic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
984843551 4:184090887-184090909 CAGGATGAACTCTCTGAGCAGGG - Exonic
989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG + Intergenic
992154773 5:73944481-73944503 AGGGAAAGACATTCTAAGCAAGG + Intergenic
992940488 5:81756552-81756574 AGGTATAAACAATCTTACCATGG + Intergenic
994603545 5:101938732-101938754 ATGGATAAACAGTCTTAGTAAGG - Intergenic
995547082 5:113243656-113243678 AAGGATAAACACACTAGGCATGG - Intronic
995689629 5:114809951-114809973 TGGAATAAACAATATGAGCAAGG + Intergenic
998034378 5:138901699-138901721 AATGAGAAACACTCTGAGCTGGG - Intronic
999324196 5:150632978-150633000 AGGGGTAGGGACTCTGAGCAGGG - Intronic
1000009752 5:157220156-157220178 TGTGAGAAACACTGTGAGCAGGG + Intronic
1000355030 5:160386074-160386096 AGGGACCAACAGTATGAGCATGG - Intergenic
1002654944 5:180738675-180738697 AGGGACTAAAACTCTGAGGACGG + Intergenic
1005216867 6:23539461-23539483 TATGATAAATACTCTGAGCAAGG - Intergenic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006600778 6:35224255-35224277 AGGGATAAGCATTGTGAGCAGGG + Intronic
1013944459 6:115704918-115704940 AGAGATAGACACTCTGAGTTTGG - Intergenic
1017440466 6:154460094-154460116 AGGGAGAAGCACCCAGAGCAGGG + Intronic
1018227948 6:161647565-161647587 AGGAATATACTCTCTGAGTATGG - Intronic
1020064624 7:5177823-5177845 AGGAAGAAAAAATCTGAGCAGGG + Intergenic
1022419447 7:30206612-30206634 AGGAATAAGCACTCAGAGCTGGG + Intergenic
1028948532 7:96608023-96608045 AGATATAAACACTCTGATGATGG + Intronic
1028996747 7:97109375-97109397 AGAGATAAACACTATGAGCAGGG + Intergenic
1037475912 8:19257569-19257591 AGGGATGAACAGGCAGAGCATGG + Intergenic
1038490775 8:27969506-27969528 AGGGATGAACAGGCGGAGCACGG + Intronic
1040004829 8:42611019-42611041 AGGGATGAACAGACAGAGCACGG + Intergenic
1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG + Intronic
1041492192 8:58445825-58445847 AGCGATAAACACTTAGAACATGG - Intronic
1043150259 8:76706078-76706100 AAGGAGAAACACCCTGAGCCGGG + Exonic
1045564747 8:103302177-103302199 AGGGATTAAAAGTCTGAGCCAGG - Intronic
1048828449 8:138452782-138452804 AGGAATGAACATTCTGAGCATGG - Intronic
1051084661 9:13334488-13334510 AGGCATCAAGACTCTGAGCTGGG + Intergenic
1051145932 9:14027271-14027293 GAGGATGGACACTCTGAGCACGG - Intergenic
1053654840 9:40206992-40207014 AGGGAAAAACACTCAGGACAGGG + Intergenic
1053717160 9:40908415-40908437 AGGGACAAACATTCAGAACACGG - Intergenic
1054075142 9:60521873-60521895 AGGGATAAACACTCAGAGCACGG + Intergenic
1054075399 9:60524169-60524191 AGGAATAAACACTCAGAGCATGG + Intergenic
1054366955 9:64353208-64353230 AGGGAAAAACACTCAGGACAGGG + Intergenic
1055576119 9:77661654-77661676 GGGGACAAACAGGCTGAGCAAGG + Intergenic
1056253588 9:84775320-84775342 AGGGAAAAACACACTGGGCTGGG - Intronic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1058208672 9:102139600-102139622 AGGACCAAATACTCTGAGCAAGG - Intergenic
1059180168 9:112204577-112204599 GTGGAAAAACACTCTGTGCATGG - Intergenic
1059963549 9:119591279-119591301 AGGCATAGAGACTCTGAGAATGG + Intergenic
1059973064 9:119687245-119687267 AAGAATAAACATTCTGGGCAGGG + Intergenic
1060963641 9:127699336-127699358 AGGCCGAAACACTGTGAGCAAGG + Intronic
1203455780 Un_GL000219v1:166121-166143 AGGGATAAACACTCAGAGCATGG + Intergenic
1203456033 Un_GL000219v1:168512-168534 AGGGATAAACACTCAGAGCATGG + Intergenic
1203484104 Un_GL000224v1:36469-36491 AGGGACAAACATTCAGACCATGG + Intergenic
1203484183 Un_GL000224v1:37088-37110 AGGGACAAACATTCAGACCACGG + Intergenic
1203484215 Un_GL000224v1:37327-37349 AGGGACAAACATTCAGACCACGG + Intergenic
1203484704 Un_GL000224v1:41783-41805 AGGGACAAACATTCAGACCACGG + Intergenic
1203485232 Un_GL000224v1:47289-47311 AGGGACAAACATTCAGACCACGG + Intergenic
1203495453 Un_GL000224v1:147108-147130 AGGGAAAAACATTCACAGCAGGG - Intergenic
1203508078 Un_KI270741v1:89031-89053 AGGGAAAAACATTCACAGCAGGG - Intergenic
1203708580 Un_KI270742v1:73953-73975 AGGGACAAACATTCAGACCACGG - Intergenic
1203708642 Un_KI270742v1:74528-74550 AGGGACAAACATTCAGACCACGG - Intergenic
1187774909 X:22745522-22745544 AGGGATGAAAATTCTGATCAGGG - Intergenic
1188564982 X:31516782-31516804 AGGGATATGCTCTCTCAGCAGGG + Intronic
1190777199 X:53562424-53562446 ATGCATCAACACACTGAGCAGGG + Intronic
1192859961 X:75057098-75057120 AGGTATAAAAACACTAAGCATGG + Intronic
1194611017 X:96044788-96044810 AGAGATAACCACTCTGAACTAGG + Intergenic
1195925789 X:110023283-110023305 AGTCATAAACACACTGAGCTTGG - Intronic
1201163190 Y:11182470-11182492 AGGGACAAACATTCAGACCACGG - Intergenic