ID: 1101592754

View in Genome Browser
Species Human (GRCh38)
Location 12:106138748-106138770
Sequence AGGTCGCCCCCGCAGCATCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101592747_1101592754 6 Left 1101592747 12:106138719-106138741 CCCCACCGAGGGAAGCCGCTGTA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1101592748_1101592754 5 Left 1101592748 12:106138720-106138742 CCCACCGAGGGAAGCCGCTGTAC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1101592750_1101592754 1 Left 1101592750 12:106138724-106138746 CCGAGGGAAGCCGCTGTACGCTC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1101592749_1101592754 4 Left 1101592749 12:106138721-106138743 CCACCGAGGGAAGCCGCTGTACG 0: 1
1: 0
2: 0
3: 6
4: 30
Right 1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1101592752_1101592754 -9 Left 1101592752 12:106138734-106138756 CCGCTGTACGCTCAAGGTCGCCC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101592754 Original CRISPR AGGTCGCCCCCGCAGCATCA GGG Exonic
902873717 1:19328799-19328821 AGGTAGACCCCGAAGCCTCAAGG + Exonic
913087331 1:115451002-115451024 AGGTAGCCCTCTCTGCATCAGGG - Intergenic
915648680 1:157292085-157292107 AGGCAGCCCCCCCAGAATCAAGG - Intergenic
1065722058 10:28636627-28636649 AGGTCACTCCTGCAGCTTCATGG - Intergenic
1066171290 10:32849905-32849927 AGTTCCCCCCTGCAGAATCAGGG - Intronic
1069752107 10:70751495-70751517 GGGTGGCCCCCGCAGCAGCCTGG + Exonic
1076234461 10:128852929-128852951 AGGTCATCTCCGCAGCTTCAGGG + Intergenic
1096677827 12:53234990-53235012 TGTCCGCCCCCCCAGCATCAGGG - Intergenic
1098194099 12:67981379-67981401 ATGTCGCCTCTGCAGCAGCAGGG + Intergenic
1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG + Exonic
1101897777 12:108768987-108769009 AGGTGGCCTCCGCAGCCCCAGGG - Intergenic
1102947965 12:117006488-117006510 AGGCGGGCCCCGCAGCATCCAGG - Intronic
1104837957 12:131804116-131804138 AGGTCGCTCCACCAGCTTCACGG + Intergenic
1104990974 12:132623665-132623687 AGGCGGCCCCAGCAGCATCCAGG + Intergenic
1105630872 13:22166112-22166134 AGCTAGCCACAGCAGCATCATGG + Intergenic
1112139554 13:96623485-96623507 AGGTAGCTCCCGCAGCTTCTAGG + Intronic
1122267664 14:100554208-100554230 AGGCCTCCCCCGCAGCCTCCAGG - Intronic
1129678211 15:77643671-77643693 AGGTGGCCACCCCAGCACCATGG + Intronic
1132841627 16:1980898-1980920 AAGCCGCCACCGCGGCATCAGGG + Exonic
1144570016 17:16391641-16391663 AGGCTGCCCCCGCGGCATCCAGG - Intergenic
1146058553 17:29593076-29593098 AGCTCAGCCCCGCGGCATCATGG - Intronic
1146939166 17:36832129-36832151 AGGTAGACCCCGCCACATCATGG - Intergenic
1151879819 17:76888196-76888218 AGGGGGCCTCCCCAGCATCAGGG + Intronic
938340327 2:130531796-130531818 AAGTCACCCCACCAGCATCAGGG - Intergenic
938349503 2:130588942-130588964 AAGTCACCCCACCAGCATCAGGG + Intergenic
941666402 2:168247432-168247454 TGCTCTCCTCCGCAGCATCATGG - Exonic
944456959 2:199905175-199905197 AGGTCCCCCCTCCAGCATCGGGG - Intergenic
946048160 2:216838270-216838292 AGGTCTCTCCCGCAGGACCATGG + Intergenic
948423044 2:237872243-237872265 AGGTGCCCCCGGCAGCACCAGGG - Intronic
948424858 2:237880758-237880780 AGGCCCCACCCCCAGCATCAAGG + Intronic
948729469 2:239953890-239953912 AGGACGCCCCCGCCGCCTCAGGG + Intronic
1178883338 21:36465621-36465643 AGGGCGCTTCCGGAGCATCACGG - Intronic
1179480190 21:41672021-41672043 AGGTCATGCCGGCAGCATCACGG + Intergenic
955769582 3:62374025-62374047 AGGACGACCCCGAAGCGTCACGG + Intronic
958034048 3:88149646-88149668 TGGCCGGCCCCGCGGCATCACGG + Intronic
970074031 4:12196972-12196994 AGGTCCCTCCCACAGCATCTGGG - Intergenic
980852714 4:138402685-138402707 AGGTCGCTCCCTCAACATCCAGG + Intergenic
992839657 5:80675624-80675646 AGGTCTCCCCCTCAGCATTGGGG + Intronic
996748131 5:126863711-126863733 AGGTAGCACACGCAGCAACATGG + Intergenic
998214484 5:140227077-140227099 AGGTGGCCCCTGGAGCATCATGG + Intronic
1015058216 6:128929958-128929980 AGATCGCCTCCGCAGGATGAGGG - Intronic
1024831665 7:53466598-53466620 AGGTCACACTGGCAGCATCATGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029537560 7:101165190-101165212 AAGTCGCCCACGCACCATCCGGG - Intronic
1038193001 8:25340987-25341009 AGGTCAGCCTGGCAGCATCATGG + Exonic
1040080456 8:43279086-43279108 GGGTCGCCCCCACAGAATAAAGG - Intergenic
1041648884 8:60281577-60281599 GGGTCGCCCCCGCCGCCTCCTGG + Intergenic
1050348679 9:4718944-4718966 AGGTTGCCCCAGGAGCAGCAGGG - Intronic
1060550974 9:124485314-124485336 TGGACGCCCCCGCAGCTGCAGGG - Intronic
1061422640 9:130480538-130480560 AGGTCGCCCACGGAGCATGGGGG - Intronic
1061994021 9:134175022-134175044 AGGACACCCCCGCAGCAACAAGG - Intergenic
1062403084 9:136380936-136380958 AGGTAGCCGCCCCAGCCTCAGGG - Intronic
1187098154 X:16168012-16168034 AGGTCTCCTCATCAGCATCAGGG - Intronic
1192846416 X:74910713-74910735 AGGTCCCTCCCACAGCATGAGGG - Intronic