ID: 1101592772

View in Genome Browser
Species Human (GRCh38)
Location 12:106138799-106138821
Sequence CTCGGTCACTGGCGGCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101592758_1101592772 21 Left 1101592758 12:106138755-106138777 CCCCGCAGCATCAGGGAGGCGGC 0: 1
1: 0
2: 1
3: 17
4: 204
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1101592759_1101592772 20 Left 1101592759 12:106138756-106138778 CCCGCAGCATCAGGGAGGCGGCC 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1101592764_1101592772 -2 Left 1101592764 12:106138778-106138800 CCGATACCGCTCGGACTGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1101592766_1101592772 -8 Left 1101592766 12:106138784-106138806 CCGCTCGGACTGCGGCTCGGTCA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1101592756_1101592772 22 Left 1101592756 12:106138754-106138776 CCCCCGCAGCATCAGGGAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 171
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1101592760_1101592772 19 Left 1101592760 12:106138757-106138779 CCGCAGCATCAGGGAGGCGGCCC 0: 1
1: 0
2: 1
3: 21
4: 182
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1101592763_1101592772 -1 Left 1101592763 12:106138777-106138799 CCCGATACCGCTCGGACTGCGGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101592772 Original CRISPR CTCGGTCACTGGCGGCGGCG GGG Exonic
903394581 1:22990021-22990043 CTGGGTCACTGGTGGCTGAGTGG + Intergenic
903759271 1:25686574-25686596 CTCGGCCACTGGCGGGGCGGTGG - Intronic
905450100 1:38050850-38050872 CTCTGAAACTGGCGGCGGCCTGG - Intergenic
912670532 1:111620123-111620145 CTCTGGCCCTGGCGGCGGCCGGG - Intronic
918365651 1:183805131-183805153 CGCGCGCACCGGCGGCGGCGGGG + Intronic
920331452 1:205211319-205211341 CTCCCTCACGGGCGGCGGCGGGG - Exonic
920385633 1:205568906-205568928 CTTGGGCCCGGGCGGCGGCGGGG - Intronic
923079804 1:230642450-230642472 GTCGTTCATTGGCCGCGGCGCGG + Intergenic
1064031527 10:11886050-11886072 CTCGGAGACTGGCAGGGGCGGGG + Intergenic
1065215040 10:23440060-23440082 CTCGGTGCTTGGCGGCGGCCAGG - Exonic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1070153569 10:73819809-73819831 CTCTGGCAGAGGCGGCGGCGTGG - Intronic
1073057949 10:100714055-100714077 CAGGGGCACTGGCGGGGGCGGGG + Intergenic
1073240719 10:102056066-102056088 CTCGGTAAGCGGCGGCGGCCAGG - Exonic
1075144576 10:119872508-119872530 TTCGGTGAGTGGCGGCGCCGGGG - Exonic
1076891323 10:133285246-133285268 CTCCGTGACCGGCGGCGTCGTGG + Intronic
1083432569 11:62621950-62621972 CTCGGGCGCGGGCGGCGGCGCGG - Exonic
1083538244 11:63491134-63491156 CTTGGGCACTGGGGGCGGCTCGG + Exonic
1096241188 12:49961313-49961335 CTCCCTCACCGCCGGCGGCGGGG - Intergenic
1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG + Exonic
1103800322 12:123533643-123533665 CGCGGGCACGGGCGGCGGCGCGG + Exonic
1112467751 13:99658598-99658620 CTCGGCCACAGGCAGCGGGGCGG + Intronic
1114066369 14:19062463-19062485 CGCGGTAAGTGGCGGGGGCGTGG + Intergenic
1114095899 14:19337561-19337583 CGCGGTAAGTGGCGGGGGCGTGG - Intergenic
1117739233 14:58798987-58799009 CTCAGTCACTGGCTGCAGCAAGG + Intergenic
1122066180 14:99175690-99175712 CGGGGACACGGGCGGCGGCGTGG + Exonic
1122318604 14:100840068-100840090 CTGGGTCACTGGGGCCGCCGTGG + Intergenic
1129020582 15:72513879-72513901 CTCTGTCTTTGGCGGAGGCGGGG - Intronic
1129199872 15:73992328-73992350 CGCGGCCACCCGCGGCGGCGCGG + Exonic
1129382859 15:75178724-75178746 CTCGGACACAGGCGGCGGGCGGG - Intergenic
1132079492 15:98852351-98852373 CTTGGTCCACGGCGGCGGCGCGG - Intronic
1137618205 16:49858859-49858881 CTCGATCCCAGGCGCCGGCGGGG - Intergenic
1139546623 16:67652849-67652871 CACGGACAGCGGCGGCGGCGGGG + Intronic
1145041309 17:19579974-19579996 GCCGGTCCTTGGCGGCGGCGGGG - Intergenic
1145265272 17:21376891-21376913 CTCGGTCAGTGGCCCGGGCGCGG - Exonic
1146958126 17:36948999-36949021 CGCGGTCTCTGGCGGAGTCGGGG + Exonic
1151825713 17:76523147-76523169 CTCGGTCTCAGGCTGCAGCGCGG + Intergenic
1157279100 18:46334186-46334208 CGCGGGCGCGGGCGGCGGCGGGG - Intronic
1160404833 18:78638189-78638211 CTTGGCCCCGGGCGGCGGCGAGG + Intergenic
1161028631 19:2047983-2048005 CTCGGTAACTGGTAGCTGCGGGG - Intronic
1161345523 19:3767171-3767193 CTCGGGCAGAGGCGGCGACGGGG - Intronic
1161477393 19:4494151-4494173 CGCTGTCACTGGAGGCGGAGGGG - Exonic
1161676388 19:5652502-5652524 CTCGGCCACTGGCTGCTGCAGGG + Intronic
1162480403 19:10923992-10924014 CACGGTCACTGGGGGGGGCAAGG + Exonic
1166735048 19:45079166-45079188 GTGGGGCAGTGGCGGCGGCGCGG + Intergenic
1167513297 19:49908397-49908419 GTGGGTCACTGGTGTCGGCGGGG + Exonic
1168612296 19:57811086-57811108 CTCGGAGACTGGTGGCGGCAGGG + Intronic
935046753 2:99489882-99489904 CGAGGGCACTGGCGGCGGCGGGG - Exonic
938483762 2:131682596-131682618 CGCGGTCAGTGGCGGGGGCGTGG + Intergenic
942447118 2:176085504-176085526 CGCGGACACAGGCGGAGGCGAGG + Intergenic
948479107 2:238239468-238239490 CGCGGTGAGTGGCGGCGGGGCGG - Exonic
948645385 2:239400894-239400916 CTCGGGCTCGGGCGGCGGCGGGG + Exonic
1170756813 20:19212500-19212522 CTCGGCCTGGGGCGGCGGCGCGG - Intergenic
1176062314 20:63177816-63177838 GGCGGGAACTGGCGGCGGCGCGG + Intergenic
1178962031 21:37073769-37073791 CGCGCTCCCTGGCGGCTGCGTGG + Intronic
1180484847 22:15785054-15785076 CGCGGTAAGTGGCGGGGGCGTGG + Intergenic
1182439832 22:30356742-30356764 CGTGGGCACGGGCGGCGGCGGGG + Exonic
1183650941 22:39152848-39152870 CTCGGTCACCGGCTGGGGCGGGG + Intergenic
1184184726 22:42857033-42857055 CACGGGCACTGGCGCCCGCGGGG + Intronic
1185301400 22:50083047-50083069 CTTGGGCACTGGCAGAGGCGTGG + Intronic
1185321290 22:50201251-50201273 CCCGGGCACGGGCCGCGGCGCGG - Exonic
950014416 3:9745678-9745700 CGTGGGCACTGGCCGCGGCGTGG + Exonic
952959614 3:38581108-38581130 CTCCGTCTCTGGGGGTGGCGGGG + Exonic
953167364 3:40477262-40477284 CCCAGGCTCTGGCGGCGGCGCGG - Exonic
954582610 3:51711195-51711217 CTCAGTCACTGGAGGTGGCTAGG + Intronic
956080246 3:65549439-65549461 CTCGGTCACTGCCGGAGCCCAGG + Intronic
956179083 3:66500913-66500935 CGCGCTCTCTGGCCGCGGCGTGG - Exonic
959312946 3:104763823-104763845 CTTGGTCACTGGAGGTGGTGTGG - Intergenic
963221015 3:142812097-142812119 CTCTGTCACTGGGGTCAGCGGGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968213331 3:196867772-196867794 CGCGGTGACGGGCGGGGGCGGGG + Intergenic
968751941 4:2394648-2394670 CTCGGTCACAGGCAGGGGCCTGG + Intronic
972396522 4:38663733-38663755 CCCGGGCTCGGGCGGCGGCGCGG + Intergenic
978361019 4:107931462-107931484 GTCGCTGAGTGGCGGCGGCGGGG + Exonic
985744205 5:1637270-1637292 CTGGGTCACTGGAGGCTGCCCGG - Intergenic
999129493 5:149271956-149271978 CTCGGTCCATGGCGCCGGCCCGG - Exonic
1002681778 5:180970460-180970482 CTCGGGCACCGGCGGTGGGGGGG - Intergenic
1003139045 6:3456415-3456437 CGCGGGCCCCGGCGGCGGCGCGG - Exonic
1006599100 6:35214108-35214130 CTCTGCCAGCGGCGGCGGCGGGG - Intergenic
1019542784 7:1559092-1559114 CCCGGTCACAGGAGGCGGCAGGG + Intronic
1022387439 7:29915019-29915041 CTCGTTCCCTGGAGGCTGCGCGG - Exonic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1030983174 7:116210455-116210477 CTCGGTGATTGGCGGCGGCCCGG + Intergenic
1034950989 7:155297368-155297390 CGCGGGCTCTGGCGGCGGGGAGG - Intergenic
1035295445 7:157864613-157864635 CACGGTGACTGGCCACGGCGGGG + Intronic
1035458465 7:159024409-159024431 CGGGGTGCCTGGCGGCGGCGAGG - Intergenic
1035470098 7:159104268-159104290 CCCGGTCACTGTCGGTGGTGAGG - Intronic
1036195272 8:6708499-6708521 CCCGGCCCCGGGCGGCGGCGCGG + Exonic
1037668686 8:20996192-20996214 CAGGGTCACTGGCGGCAGTGGGG + Intergenic
1047998573 8:130358561-130358583 CGCGCTGACAGGCGGCGGCGCGG + Intronic
1049709786 8:144058305-144058327 CTCGGGCCCGGCCGGCGGCGTGG - Exonic
1061517665 9:131098816-131098838 CTCTGTCACTGGCTTCTGCGTGG - Intronic
1061712746 9:132499038-132499060 CACAGTCCCTGCCGGCGGCGGGG - Intronic
1190877501 X:54470352-54470374 CTGGGGCACTGGTGGCTGCGAGG + Exonic