ID: 1101592888

View in Genome Browser
Species Human (GRCh38)
Location 12:106139164-106139186
Sequence GACTCGCCCTTTGTGCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101592883_1101592888 13 Left 1101592883 12:106139128-106139150 CCGCCGTGAGCTGGGAGGGGGAT 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 42
1101592874_1101592888 26 Left 1101592874 12:106139115-106139137 CCCGGGGCCGGGGCCGCCGTGAG 0: 1
1: 0
2: 0
3: 43
4: 389
Right 1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 42
1101592873_1101592888 29 Left 1101592873 12:106139112-106139134 CCACCCGGGGCCGGGGCCGCCGT 0: 1
1: 0
2: 9
3: 39
4: 294
Right 1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 42
1101592875_1101592888 25 Left 1101592875 12:106139116-106139138 CCGGGGCCGGGGCCGCCGTGAGC 0: 1
1: 0
2: 4
3: 32
4: 367
Right 1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 42
1101592885_1101592888 10 Left 1101592885 12:106139131-106139153 CCGTGAGCTGGGAGGGGGATGGG 0: 1
1: 0
2: 7
3: 70
4: 593
Right 1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 42
1101592878_1101592888 19 Left 1101592878 12:106139122-106139144 CCGGGGCCGCCGTGAGCTGGGAG 0: 1
1: 0
2: 0
3: 38
4: 328
Right 1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101592888 Original CRISPR GACTCGCCCTTTGTGCGGCG CGG Exonic
912514616 1:110210258-110210280 GACGCGCCCTTCGCGGGGCGGGG - Intergenic
1071870582 10:89789818-89789840 GACTGGCCTTTTGGGCTGCGTGG - Intergenic
1072804892 10:98418018-98418040 GGCTGGCCCTGTGTGCAGCGAGG - Intronic
1076779123 10:132714288-132714310 GAGCCGCCCTTTGTGTTGCGCGG - Intronic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1077296260 11:1827612-1827634 GACTCGGCCTGTGTGAGGTGCGG + Intergenic
1085820516 11:79788251-79788273 GGCTCTCCCTTTGTGAGGTGTGG - Intergenic
1092605271 12:10111712-10111734 GACTCGCCCTCGGGGCGGCCTGG - Intergenic
1097832753 12:64242766-64242788 GACTCTCCCTTTGTGCCTTGTGG + Intergenic
1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG + Exonic
1108196436 13:48000703-48000725 GACTTGCCTTTTGTGGGGCAAGG - Intronic
1113653929 13:112056592-112056614 GAAACGCCTTTTGTGTGGCGCGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121324049 14:93009546-93009568 GAATCGCCCTTTCTGCTTCGGGG - Intronic
1124910530 15:33915861-33915883 GACTGGCCTTTTGGGCAGCGTGG + Intronic
1125350178 15:38758444-38758466 GCCTCGCCCTTTGCGAGGCCTGG + Intergenic
1125470770 15:40001236-40001258 GAAGCTCCCTTTGTGCAGCGTGG - Intronic
1133000285 16:2847359-2847381 GACCCTCCCCTTGTTCGGCGGGG - Intergenic
1133161581 16:3915541-3915563 GCCCCGCCCTCTGTGCGGTGTGG - Intergenic
1152556753 17:81057140-81057162 GCCCCGCCCTTTCTGCGGCCTGG + Intronic
1152650712 17:81491363-81491385 GACCCTCCCTTGGTGGGGCGTGG - Intergenic
1154940869 18:21111694-21111716 GACTCGCCCTTTCCCCGGCTGGG - Exonic
1155964101 18:32019622-32019644 GACTTGCCCTTTGAGGGGCTGGG - Intronic
1160969873 19:1762766-1762788 CACTCGCGCCTGGTGCGGCGCGG - Intronic
1163785582 19:19273311-19273333 GGGTCGACCTTTGTGCGGGGCGG - Intronic
1165174860 19:33921293-33921315 GATTAGCCCCTTGTGCGGAGGGG + Intergenic
936109196 2:109651110-109651132 GCCTCTCCCTTTGTGGGGAGAGG - Intergenic
937663000 2:124452220-124452242 GACCAGCCCTTTGTGTTGCGTGG + Intronic
940329644 2:152460596-152460618 CACTTGCCCCTTGTGCGGCCTGG - Intronic
942139785 2:172966488-172966510 GAATCGCCCTTTGAGCAGCAAGG + Intronic
1184276489 22:43411983-43412005 GACTCCTCCTTCGTGGGGCGGGG - Intronic
1184823905 22:46933970-46933992 GACTCCCACTTTGTGGGGTGTGG + Intronic
976791249 4:88880812-88880834 GACTGGCCTTTTGGGCTGCGTGG + Intronic
1005496010 6:26388442-26388464 GAATCTCCCTTTGTGAGGAGGGG - Intronic
1030183634 7:106737185-106737207 GACTCCTCCTTTGTGGGGAGTGG - Intergenic
1032020758 7:128406098-128406120 GCTGAGCCCTTTGTGCGGCGCGG - Intronic
1033705580 7:143882659-143882681 GACTCGGCCTGGGTGCTGCGGGG - Intronic
1035354456 7:158268743-158268765 CACCCGCCCTGTGTGCGGCTGGG - Intronic
1041184782 8:55287658-55287680 AACTCACCCTTTGTGGGGAGGGG + Intronic
1056026076 9:82496419-82496441 GACTCGCCTTTTGGGCTGCATGG - Intergenic
1186883068 X:13885688-13885710 GCCTGGCCCTTGGTGGGGCGGGG - Intronic
1191820433 X:65300343-65300365 GACTTGCCTTTTGTGCTGCGTGG + Intergenic
1192510566 X:71718388-71718410 AGCACGCCCTTTGTGGGGCGAGG + Intergenic
1192516131 X:71763165-71763187 AGCACGCCCTTTGTGGGGCGAGG - Intergenic
1196966724 X:121064633-121064655 GACTGGCCTTTTGGGCTGCGTGG - Intergenic