ID: 1101597176

View in Genome Browser
Species Human (GRCh38)
Location 12:106177817-106177839
Sequence ATAGCCTCTTCCCACCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101597176_1101597177 18 Left 1101597176 12:106177817-106177839 CCATTAGGGTGGGAAGAGGCTAT No data
Right 1101597177 12:106177858-106177880 TTTTCAAAGAAATCCCTTTGTGG No data
1101597176_1101597179 23 Left 1101597176 12:106177817-106177839 CCATTAGGGTGGGAAGAGGCTAT No data
Right 1101597179 12:106177863-106177885 AAAGAAATCCCTTTGTGGGAAGG No data
1101597176_1101597178 19 Left 1101597176 12:106177817-106177839 CCATTAGGGTGGGAAGAGGCTAT No data
Right 1101597178 12:106177859-106177881 TTTCAAAGAAATCCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101597176 Original CRISPR ATAGCCTCTTCCCACCCTAA TGG (reversed) Intergenic
No off target data available for this crispr