ID: 1101597177

View in Genome Browser
Species Human (GRCh38)
Location 12:106177858-106177880
Sequence TTTTCAAAGAAATCCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101597175_1101597177 21 Left 1101597175 12:106177814-106177836 CCGCCATTAGGGTGGGAAGAGGC No data
Right 1101597177 12:106177858-106177880 TTTTCAAAGAAATCCCTTTGTGG No data
1101597176_1101597177 18 Left 1101597176 12:106177817-106177839 CCATTAGGGTGGGAAGAGGCTAT No data
Right 1101597177 12:106177858-106177880 TTTTCAAAGAAATCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101597177 Original CRISPR TTTTCAAAGAAATCCCTTTG TGG Intergenic
No off target data available for this crispr