ID: 1101597179

View in Genome Browser
Species Human (GRCh38)
Location 12:106177863-106177885
Sequence AAAGAAATCCCTTTGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101597175_1101597179 26 Left 1101597175 12:106177814-106177836 CCGCCATTAGGGTGGGAAGAGGC No data
Right 1101597179 12:106177863-106177885 AAAGAAATCCCTTTGTGGGAAGG No data
1101597176_1101597179 23 Left 1101597176 12:106177817-106177839 CCATTAGGGTGGGAAGAGGCTAT No data
Right 1101597179 12:106177863-106177885 AAAGAAATCCCTTTGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101597179 Original CRISPR AAAGAAATCCCTTTGTGGGA AGG Intergenic
No off target data available for this crispr