ID: 1101599783

View in Genome Browser
Species Human (GRCh38)
Location 12:106199059-106199081
Sequence CATTTCCCCTGAATCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101599780_1101599783 5 Left 1101599780 12:106199031-106199053 CCCATCCATTGAGAGGTGGGATC No data
Right 1101599783 12:106199059-106199081 CATTTCCCCTGAATCTGAGCTGG No data
1101599782_1101599783 0 Left 1101599782 12:106199036-106199058 CCATTGAGAGGTGGGATCTATTT No data
Right 1101599783 12:106199059-106199081 CATTTCCCCTGAATCTGAGCTGG No data
1101599781_1101599783 4 Left 1101599781 12:106199032-106199054 CCATCCATTGAGAGGTGGGATCT No data
Right 1101599783 12:106199059-106199081 CATTTCCCCTGAATCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101599783 Original CRISPR CATTTCCCCTGAATCTGAGC TGG Intergenic
No off target data available for this crispr