ID: 1101604469

View in Genome Browser
Species Human (GRCh38)
Location 12:106237552-106237574
Sequence TTGAATAGGCATAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101604469_1101604475 -2 Left 1101604469 12:106237552-106237574 CCAGCCTCTTTATGCCTATTCAA 0: 1
1: 0
2: 3
3: 16
4: 199
Right 1101604475 12:106237573-106237595 AATCAGCATCTGTGCGGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 158
1101604469_1101604476 4 Left 1101604469 12:106237552-106237574 CCAGCCTCTTTATGCCTATTCAA 0: 1
1: 0
2: 3
3: 16
4: 199
Right 1101604476 12:106237579-106237601 CATCTGTGCGGGCAGGGCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1101604469_1101604479 25 Left 1101604469 12:106237552-106237574 CCAGCCTCTTTATGCCTATTCAA 0: 1
1: 0
2: 3
3: 16
4: 199
Right 1101604479 12:106237600-106237622 GGCATTTTTTAAAAGCTCCTAGG 0: 1
1: 2
2: 12
3: 89
4: 585
1101604469_1101604473 -7 Left 1101604469 12:106237552-106237574 CCAGCCTCTTTATGCCTATTCAA 0: 1
1: 0
2: 3
3: 16
4: 199
Right 1101604473 12:106237568-106237590 TATTCAATCAGCATCTGTGCGGG 0: 1
1: 0
2: 1
3: 17
4: 169
1101604469_1101604472 -8 Left 1101604469 12:106237552-106237574 CCAGCCTCTTTATGCCTATTCAA 0: 1
1: 0
2: 3
3: 16
4: 199
Right 1101604472 12:106237567-106237589 CTATTCAATCAGCATCTGTGCGG 0: 1
1: 0
2: 3
3: 30
4: 391
1101604469_1101604474 -3 Left 1101604469 12:106237552-106237574 CCAGCCTCTTTATGCCTATTCAA 0: 1
1: 0
2: 3
3: 16
4: 199
Right 1101604474 12:106237572-106237594 CAATCAGCATCTGTGCGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101604469 Original CRISPR TTGAATAGGCATAAAGAGGC TGG (reversed) Intergenic
900002999 1:25264-25286 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
900022719 1:195789-195811 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
902135773 1:14303693-14303715 TTGGATAGGCATAAATGGGAAGG - Intergenic
902203334 1:14850228-14850250 TAGAAAAAGCATAAATAGGCTGG - Intronic
902419637 1:16268665-16268687 TTTAATAAGAACAAAGAGGCCGG + Intronic
902533344 1:17104727-17104749 TTGAAAAGGCAAAAAGAGGCCGG - Intronic
902657599 1:17880124-17880146 GGGAATAGGCAGGAAGAGGCTGG - Intergenic
904694578 1:32321667-32321689 TTGACTAGGAATAAAAGGGCTGG + Intronic
906259269 1:44374192-44374214 TTGAATTGGGATAAGGGGGCTGG - Intergenic
907202354 1:52738559-52738581 TTGAATAGGCATTAAGACACTGG - Intronic
907481191 1:54746573-54746595 TTTAATAAAAATAAAGAGGCAGG - Intergenic
907554902 1:55335089-55335111 TTTAAATGGCCTAAAGAGGCTGG + Intergenic
908002567 1:59694898-59694920 TTGGATAGGCATAGAGAGTATGG + Intronic
911468670 1:98287752-98287774 TTTAATAGGAATAAAGAAGTAGG + Intergenic
912157986 1:106945829-106945851 TTGAATAGACATAATGTGTCAGG + Intergenic
914709079 1:150196565-150196587 GTGAATATTCATAAAGAGGGGGG - Intergenic
915980980 1:160419842-160419864 ATGAATAGGCATTTAGAGGTAGG + Intronic
916729061 1:167550282-167550304 TTTAAAATGCATATAGAGGCGGG - Intronic
921553922 1:216573986-216574008 TTGAAAAGGTATACAGAGACAGG - Intronic
921809966 1:219501616-219501638 TAAAATATGCCTAAAGAGGCAGG - Intergenic
923350035 1:233095541-233095563 CTGAATATGCATTAAGAAGCAGG + Intronic
923487575 1:234449168-234449190 CTGAAGTGGCATAAACAGGCAGG + Intronic
1063260378 10:4382135-4382157 TAGAATAGACATCAATAGGCCGG - Intergenic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1068157277 10:53216967-53216989 TTGAAAAGGGACAAAGAGGAAGG - Intergenic
1069918447 10:71801448-71801470 TTTAAGAGACATAAATAGGCCGG - Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1072420202 10:95284648-95284670 TTGAAAATGCATACAGAGGCTGG - Intronic
1074011612 10:109487582-109487604 TTTAAAAGGCACAGAGAGGCCGG - Intergenic
1075299787 10:121311797-121311819 ATAAACAGGCATCAAGAGGCTGG + Intergenic
1081061523 11:38483939-38483961 TTGAAAAGGCATAAAGAAACAGG + Intergenic
1085478138 11:76800602-76800624 TGTGAAAGGCATAAAGAGGCTGG - Intergenic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091376417 12:27327-27349 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1093677011 12:21954322-21954344 TTGAATAGGAATAATGAGAGTGG + Intergenic
1095333418 12:40996968-40996990 TTCAATCAGCATAATGAGGCTGG - Intronic
1097575762 12:61390498-61390520 TTAAATATGCATAAATAGGCAGG + Intergenic
1099580056 12:84434714-84434736 TTGACTAGGCTAAAAGATGCCGG - Intergenic
1101260488 12:103024743-103024765 TTGAAAAGGAAAAAAGATGCTGG - Intergenic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1102740894 12:115206742-115206764 TTGAAAAAACATATAGAGGCCGG - Intergenic
1103003749 12:117405892-117405914 TAGATGAGGCAAAAAGAGGCTGG + Intronic
1103900071 12:124298968-124298990 TTGAGGAGCCACAAAGAGGCAGG + Intronic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1107456754 13:40562625-40562647 CTGAATAGGAATAGAGAAGCAGG - Intronic
1107819613 13:44274357-44274379 GAGAATAGGCATAGGGAGGCAGG - Intergenic
1112192492 13:97191576-97191598 TCAAATAGGCATGGAGAGGCTGG - Intergenic
1113266895 13:108629454-108629476 TTGAAAAGCCATTAACAGGCAGG + Intronic
1115540948 14:34420899-34420921 TTGAATAGGGCTAATTAGGCAGG + Intronic
1118209010 14:63749520-63749542 TTTAATAGGCAAAGAAAGGCCGG - Intergenic
1118646511 14:67846189-67846211 ATGAATATGCACACAGAGGCTGG - Intronic
1122579743 14:102764100-102764122 TAGGATAGGGTTAAAGAGGCCGG - Intergenic
1124858087 15:33410353-33410375 TTGAATTGGAATGAACAGGCAGG + Intronic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1130620568 15:85457843-85457865 TTAAAAAGTTATAAAGAGGCCGG + Intronic
1131223563 15:90605601-90605623 TTGAATCTGTAAAAAGAGGCTGG + Intronic
1132450507 15:101965675-101965697 TTGCAGAGGAAAAAAGAGGCTGG - Intergenic
1132628884 16:906744-906766 TTGAAGAAGAATAAAGATGCAGG - Intronic
1138223258 16:55270944-55270966 TTGAAATGGATTAAAGAGGCAGG + Intergenic
1138452419 16:57101585-57101607 TGGATTTGGCATAATGAGGCAGG - Intronic
1143082080 17:4389199-4389221 TTGAATGGGCAAAAGAAGGCGGG + Intergenic
1143355541 17:6325443-6325465 GGGAATAGGCATGCAGAGGCAGG - Intergenic
1144149671 17:12431143-12431165 ATGAGTGGGTATAAAGAGGCTGG - Intergenic
1146084190 17:29812578-29812600 TTTAAAATGCATAAATAGGCTGG - Intronic
1146223391 17:31046126-31046148 GAGAATAGGCATAAAAAGGGCGG - Intergenic
1146351202 17:32095779-32095801 GAGAATAGGCATAAAAAGGGCGG - Intergenic
1147233038 17:39033138-39033160 GAGAATAGGCATAAAAAGGGAGG + Intergenic
1148173729 17:45546685-45546707 GAGAATAGGCATAAAAAGGGAGG - Intergenic
1148275540 17:46298763-46298785 GAGAATAGGCATAAAAAGGGAGG + Intronic
1148297646 17:46516331-46516353 GAGAATAGGCATAAAAAGGGAGG + Intronic
1148362198 17:47020821-47020843 GAGAATAGGCATAAAAAGGGAGG + Intronic
1150404940 17:64893609-64893631 GAGAATAGGCATAAAAAGGGAGG - Intronic
1150533724 17:66013784-66013806 GTGAATGCGCATACAGAGGCTGG - Intronic
1150784034 17:68148535-68148557 GAGAATAGGCATAAAAAGGGAGG - Intergenic
1153232542 18:2953156-2953178 TGGAATAGGGAGAAAAAGGCTGG + Intronic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1155562754 18:27097348-27097370 TTGAATAGGCATAGTGAGAATGG - Intronic
1158606523 18:58900912-58900934 TTAAATAGGCAAATAGAGACAGG - Intronic
1158922545 18:62209557-62209579 TTGAAAAGGAATAAAGATGGAGG - Intronic
1159127752 18:64244882-64244904 TTGCATAAGCATAAATGGGCGGG + Intergenic
1159596961 18:70391682-70391704 TTAAAAAGGAAGAAAGAGGCTGG - Intergenic
1160634750 19:66872-66894 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1161645389 19:5450321-5450343 TTAAATATGGATCAAGAGGCAGG + Intergenic
1165021909 19:32931883-32931905 TTGAAAAATCATACAGAGGCCGG + Intronic
1166390325 19:42405671-42405693 TTCAAAAGGGATAAGGAGGCTGG + Intronic
1167670602 19:50851148-50851170 TTGGTTAGGCATAAATAAGCAGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
927543998 2:23937154-23937176 TTGAATAGAAATGAAGAGGCTGG - Intronic
927659449 2:24980478-24980500 ATGATAAGGCATACAGAGGCTGG - Intergenic
927792258 2:26019542-26019564 TTAAATAGGTTAAAAGAGGCCGG - Intergenic
928646464 2:33357712-33357734 TTCAATTTGCATGAAGAGGCTGG - Intronic
929021779 2:37560561-37560583 ATCACTAGGCCTAAAGAGGCAGG - Intergenic
929158131 2:38806410-38806432 TTGAATAAGAATAAACAGACTGG - Intronic
931847340 2:66218298-66218320 GTGAATAGGGATATAGAGGAGGG + Intergenic
931890453 2:66665666-66665688 TTGAAGAGACTTAAAGAGGCAGG - Intergenic
932207378 2:69894972-69894994 TTAAAAAGGTAAAAAGAGGCTGG - Intronic
932292803 2:70596683-70596705 TTGAAAAGGCAGAAAGAGCTGGG - Intergenic
932782502 2:74569736-74569758 TTAAATAGGTAGAAAGAGACAGG + Intronic
935549791 2:104440846-104440868 TTTAATAAGCATAAATAGTCTGG - Intergenic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
941943013 2:171063541-171063563 TTGAACAGGCAAAAATAGGGGGG + Intronic
942042063 2:172076696-172076718 ATGAATGGCCATAAAGATGCTGG + Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
944691780 2:202165091-202165113 TTAAACAGGCTTAAAGAGCCAGG - Intronic
945791081 2:214306413-214306435 TTGAATAGGCATAGTGAGAGAGG + Intronic
947282505 2:228470979-228471001 TTCAACAGACATAAATAGGCAGG - Intergenic
947972402 2:234335161-234335183 TTGAATATAAATAAAGAAGCAGG - Intergenic
948104128 2:235399407-235399429 TTGCATTGCCATAAAGAGACTGG - Intergenic
1174713312 20:52729749-52729771 TAGAAAATGCATAAACAGGCTGG - Intergenic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1179884634 21:44308464-44308486 GTGAATAGGCATGGAGAGGTAGG + Intronic
1181589500 22:23875264-23875286 ATTAATAGGCATAGAGAGGCAGG - Intronic
1182568303 22:31216225-31216247 TTAAATAGGCTTAAAGAAGGTGG + Intronic
949302167 3:2596745-2596767 TTGAATAGTGATAAAGAGCATGG - Intronic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951747191 3:25992340-25992362 TTGATTATTCATAAAGAGGTGGG - Intergenic
952801976 3:37302090-37302112 TTTAAAAGGCAGAAAAAGGCCGG - Intronic
953318521 3:41950846-41950868 TTTAAAAGACATAAATAGGCTGG + Intronic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
961553560 3:127682395-127682417 GTAAAAAGGCATGAAGAGGCCGG - Intergenic
962632443 3:137292567-137292589 TGGAATAGGCATATAGTGGGTGG + Intergenic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
965691684 3:171363888-171363910 TTGAATAAGCCAAAACAGGCGGG + Intronic
967192610 3:186997948-186997970 TTAAAAAAGCAAAAAGAGGCCGG + Intronic
968074366 3:195808498-195808520 TAGAAAAGGCATAAAGGGCCGGG - Intronic
968113933 3:196074583-196074605 TTAAAAAGGCATAAAGTGGACGG + Intronic
972121297 4:35707645-35707667 TTAAATAGGCATAGTGAGACTGG + Intergenic
972304297 4:37817287-37817309 GAAAATAGGCATAAATAGGCCGG + Intergenic
972716225 4:41649101-41649123 TTTAAAAGGCCTAATGAGGCTGG + Intronic
973323930 4:48838019-48838041 TTGAAAAGACAAAAAGCGGCTGG + Intronic
974606956 4:64165197-64165219 TTGAACAAGCCTAAAGAAGCTGG + Intergenic
974650439 4:64748148-64748170 GTGAATATGCATAAAGTGCCCGG - Intergenic
975787708 4:77910259-77910281 TGGTATAGGGATAAAGAGCCTGG - Intronic
976223096 4:82773800-82773822 TTGAAAATGCACATAGAGGCCGG + Intronic
976238224 4:82923971-82923993 TTAAATAAGCATATAGTGGCCGG + Intronic
976527492 4:86111264-86111286 TTTAATAGGCATGAAGAGAGAGG + Intronic
976720894 4:88167670-88167692 TTTAAAAGGCAGAAAGAGCCTGG - Intronic
977751926 4:100620303-100620325 TTTAATAGGCAAGAAGGGGCAGG + Intronic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
980050538 4:128034946-128034968 TTGAAAAGGAATAGACAGGCCGG - Intronic
980451811 4:132983382-132983404 TTGAGTAGCCCTCAAGAGGCTGG + Intergenic
981239055 4:142452539-142452561 TTGAAGAGGTATAAAGAAACTGG + Intronic
982105546 4:152008954-152008976 TTGAAAAGGTTTAAAGATGCAGG + Intergenic
984660664 4:182371300-182371322 TTAAAAAGGCAAAAAGATGCTGG - Intronic
985335450 4:188887918-188887940 ATTAAGAGACATAAAGAGGCTGG - Intergenic
986089317 5:4488456-4488478 TTGATTTGGCCTAAAAAGGCAGG + Intergenic
987618744 5:20310955-20310977 TTGAAGACTCATAAAGTGGCTGG - Intronic
987679810 5:21120715-21120737 TTGCATAGTGTTAAAGAGGCTGG + Intergenic
988351722 5:30117452-30117474 ATAAATAGGCATAAAGAGTTTGG + Intergenic
988714101 5:33807821-33807843 GTTAATAGGCAAAAAGAAGCAGG + Intronic
989007238 5:36828439-36828461 TTGAAAAGGCCTAAAGAGGCTGG + Intergenic
990745474 5:58955111-58955133 TTGAATAGGAATAGAGAGAGAGG + Intergenic
991949445 5:71933361-71933383 GTGAAAAGGCATATAGAGGGCGG - Intergenic
994099462 5:95877826-95877848 TGTAAAAGGCATAAAGAGGCCGG + Intergenic
994424827 5:99572076-99572098 TTGAATAGGCATGGTGAGGGTGG - Intergenic
995521618 5:113012501-113012523 TGGAATAGACATCAAGAGGCTGG - Intronic
996374229 5:122787167-122787189 TGGAAGAGGCATGGAGAGGCAGG + Intronic
997045874 5:130316981-130317003 TTCTATAGGCAAAAAGAGGCAGG + Intergenic
999895155 5:156024671-156024693 TTTTATAAGGATAAAGAGGCTGG + Intronic
1000128008 5:158266332-158266354 TTAAATAGATTTAAAGAGGCTGG + Intergenic
1000572369 5:162930693-162930715 TTGAAATGTCATTAAGAGGCAGG + Intergenic
1004402506 6:15302117-15302139 TTGAAGAGTAATGAAGAGGCCGG + Intronic
1004868727 6:19881184-19881206 TTGAATAAGCGTAAAGATGCAGG + Intergenic
1007009662 6:38403405-38403427 TTAAAAAGGCATAAAGAATCTGG + Intronic
1007938262 6:45753156-45753178 TTGAACAGGCACGAAGAGCCAGG - Intergenic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1013469021 6:110444617-110444639 TTGGACAGTCACAAAGAGGCCGG + Intronic
1013876796 6:114840935-114840957 TTTAAAAGGCATAGAGTGGCAGG + Intergenic
1013894594 6:115071111-115071133 TTGAATAGGGCTAACTAGGCGGG - Intergenic
1014435062 6:121411660-121411682 TAGAAAAGACATAAAAAGGCCGG + Intergenic
1015388230 6:132650759-132650781 TGGAATAGGCATAAAGAGATGGG - Intergenic
1015912365 6:138181736-138181758 TTCAAAAGGGATGAAGAGGCTGG - Intronic
1016609661 6:145974217-145974239 TAGAAAAAGCATACAGAGGCCGG + Intergenic
1018659533 6:166073406-166073428 TTGAAAAGGAATGAAGATGCTGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1028545724 7:91997556-91997578 TGGAGTAGGCATAAAGACTCAGG + Intronic
1033666651 7:143446954-143446976 TTTAATAGGCACTGAGAGGCTGG - Intergenic
1034993855 7:155565958-155565980 TGGAATAAGCATAATGATGCTGG - Intergenic
1035991853 8:4500091-4500113 GTGAAAAGGTATAAAGAGGCTGG + Intronic
1038393873 8:27232221-27232243 TTGAATAGGCACAAAGGGAGAGG - Intergenic
1039818264 8:41113882-41113904 CTGAATAAGCATAAATAGCCAGG + Intergenic
1041411805 8:57564668-57564690 TTAAAAAGGCAGAAAGTGGCTGG + Intergenic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1044718292 8:95121478-95121500 TTGAAGAGGCACAAAGATGGTGG + Intergenic
1044943889 8:97372366-97372388 TTGAAAAGGAATAACAAGGCTGG + Intergenic
1046011602 8:108555351-108555373 TTAACTAGGCAGGAAGAGGCTGG + Intergenic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046627580 8:116591513-116591535 TTAAATCGACAAAAAGAGGCTGG + Intergenic
1047716159 8:127597022-127597044 TTGGCTTGGCTTAAAGAGGCAGG + Intergenic
1048420498 8:134273804-134273826 TTCCGGAGGCATAAAGAGGCTGG + Intergenic
1049357110 8:142194388-142194410 TTGAGTAGAAACAAAGAGGCAGG + Intergenic
1049885803 9:25377-25399 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1049905937 9:216231-216253 GTCAAAAGGCATAAAGAGGCTGG + Intronic
1050193549 9:3056120-3056142 TTGAAAAGTCAGTAAGAGGCTGG + Intergenic
1050377304 9:4985829-4985851 TTAAAAAGGAATAAGGAGGCGGG - Intronic
1050701434 9:8343972-8343994 TTGATCAGGAATAAAGAGACAGG + Intronic
1052361802 9:27569988-27570010 ATGAGTAGGCATACAGAGCCTGG + Intronic
1054759078 9:68988745-68988767 TACAAAAGTCATAAAGAGGCTGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1057205203 9:93167766-93167788 TTCAAAAGGCCAAAAGAGGCTGG - Intergenic
1057577866 9:96257958-96257980 TTGGATAGCAATAAAGGGGCCGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059943451 9:119380997-119381019 TTGATTAGGGTCAAAGAGGCTGG - Intergenic
1060734686 9:126059441-126059463 TTAAATAGGGATAATAAGGCCGG + Intergenic
1185571624 X:1139009-1139031 TTTAATAGGTTGAAAGAGGCAGG - Intergenic
1187332891 X:18356348-18356370 TTCAAAAGCCAGAAAGAGGCCGG + Intergenic
1187787852 X:22913335-22913357 TTGAGTTGGCACAATGAGGCTGG - Intergenic
1189407511 X:40738074-40738096 TTTAATTTGCATAGAGAGGCAGG + Intergenic
1193151460 X:78128900-78128922 TTTAATATACATTAAGAGGCCGG + Exonic
1194607215 X:95995562-95995584 TTAAAAAGGCATATAGAGGGTGG - Intergenic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1197767156 X:130066761-130066783 TTGAATGGGGAGAAAGGGGCTGG + Exonic
1198101348 X:133424813-133424835 TTGCACAGGCAAAAAGAGACAGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic