ID: 1101604583

View in Genome Browser
Species Human (GRCh38)
Location 12:106238506-106238528
Sequence CTGTCAGCTCTGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101604583_1101604586 -6 Left 1101604583 12:106238506-106238528 CCCTCCTCATTCAGAGCTGACAG 0: 1
1: 0
2: 1
3: 32
4: 245
Right 1101604586 12:106238523-106238545 TGACAGCTATGAGCTTTAACCGG 0: 1
1: 0
2: 0
3: 9
4: 73
1101604583_1101604587 4 Left 1101604583 12:106238506-106238528 CCCTCCTCATTCAGAGCTGACAG 0: 1
1: 0
2: 1
3: 32
4: 245
Right 1101604587 12:106238533-106238555 GAGCTTTAACCGGTTCAAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101604583 Original CRISPR CTGTCAGCTCTGAATGAGGA GGG (reversed) Exonic
900173972 1:1283991-1284013 CTGGCAGCTCTGAAGCAGGATGG - Exonic
900682779 1:3925982-3926004 CAGTCAGGGCTGCATGAGGATGG - Intergenic
900890263 1:5444502-5444524 CTGTCAGCTGAGGATGGGGAAGG - Intergenic
902548413 1:17205017-17205039 TTGACAGCCCTGAGTGAGGAGGG + Intergenic
903586011 1:24415791-24415813 TTGGCAGCTCTGAATTGGGAAGG + Exonic
904113278 1:28143470-28143492 CTGACAGCTCTGTAAGGGGAGGG - Intergenic
905766519 1:40606199-40606221 CTGTCATCTCAGCATGAGGCAGG + Intergenic
906058511 1:42933690-42933712 CAGGCTGCTCTGAATGAGGGTGG + Intronic
906177985 1:43792381-43792403 TTGACAACTCTGAATGAAGAGGG - Intronic
906448765 1:45925663-45925685 TTGTCAGCCCTGAAGTAGGAGGG + Intronic
906939666 1:50245063-50245085 CTTTCAGCTCTGACTGGGGCAGG + Intergenic
907256164 1:53180685-53180707 CTCTGAGCTCTGACTGAGGGTGG + Intergenic
907459115 1:54594700-54594722 CTGCCAGCTGTGCATGGGGAGGG + Intronic
908421668 1:63964564-63964586 CTGTAAGCTCCGAGTGGGGAAGG - Intronic
908421676 1:63964619-63964641 CTATCACCTCAGAATTAGGAAGG - Intronic
909538524 1:76765527-76765549 CTATCAGGTCTGAATGAAGACGG - Intergenic
912585397 1:110759930-110759952 ATGTCAGCTCTGCAAGAGCAGGG - Intergenic
913264608 1:117032200-117032222 CTGGCAGCTCTGAATGGGGCTGG - Intronic
913349657 1:117843125-117843147 CTGACATGTGTGAATGAGGATGG + Intergenic
915141182 1:153769586-153769608 CTGCCATCTCTGAAGGATGAAGG - Intronic
917164009 1:172091265-172091287 CTGTAAGCTCCTAATGAGCAGGG - Intronic
917779957 1:178383741-178383763 CTGTGAATTCTGAATTAGGAGGG - Intronic
918310756 1:183283614-183283636 CTACAAGCACTGAATGAGGAAGG + Intronic
919407145 1:197199912-197199934 CAGTTAGCTCTGAATGAAAAGGG + Exonic
919862141 1:201747047-201747069 CTTTCAGGTATGAAGGAGGAAGG + Intronic
920375926 1:205507956-205507978 CTGGCAGTTATGAATGAGGCAGG + Intronic
921778105 1:219126427-219126449 GTCTCAGCTGTGAGTGAGGAAGG - Intergenic
924925323 1:248674671-248674693 CTGTGAGCTCTATAGGAGGAGGG + Intergenic
1063727652 10:8656133-8656155 CTGCCAGTTCTGAGTGAGGAGGG + Intergenic
1064728982 10:18309823-18309845 CAGTCACCTGAGAATGAGGAAGG + Intronic
1065536674 10:26721858-26721880 CTGTCAGAACTGAAAGAGGCAGG - Intronic
1067108933 10:43384923-43384945 GTGTCAGCACTGCATGGGGAAGG - Intergenic
1068962855 10:62882798-62882820 CTGTCAGCTCTCAGTGGGGCTGG + Intronic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1074544324 10:114390780-114390802 CCCTCAGCTCTGCATGAAGATGG + Intronic
1076258800 10:129049722-129049744 CTGTGAGTTATGAATGAGCATGG + Intergenic
1078251983 11:9623590-9623612 CTGTCACCTCTCAATGGGAAAGG + Intergenic
1078483888 11:11704392-11704414 CAGTTAACTCTGACTGAGGAAGG + Intergenic
1080880789 11:36318534-36318556 CTGTTAGCTATGAATCACGATGG + Intronic
1081379324 11:42395117-42395139 CTGGCACATGTGAATGAGGACGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1081911381 11:46701881-46701903 GTGTCAGCAGTGAGTGAGGAAGG + Intronic
1083175334 11:60946364-60946386 CTGCCCGCTGTGACTGAGGATGG - Intronic
1083925566 11:65804028-65804050 CTGTCCGCTGTGCATGGGGAGGG - Intergenic
1083962664 11:66022967-66022989 CCGGAAGCCCTGAATGAGGAAGG + Exonic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1085110358 11:73882376-73882398 ATGTCAACTCTTAAGGAGGAGGG + Intronic
1085234839 11:75006322-75006344 CTGGCTGCTCTGGAGGAGGAGGG + Exonic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1086668111 11:89510195-89510217 CTGTAAGATCTGAATGAGCAGGG - Intergenic
1086762936 11:90656342-90656364 CTGCTAGCTTTGAATGCGGAAGG - Intergenic
1088658682 11:112025781-112025803 CAGTCAGCTCTGAAGGACAACGG - Intronic
1089257504 11:117201640-117201662 CTGTCAGCCCTGAGAAAGGAAGG + Intronic
1089601986 11:119622044-119622066 CAGAAAGCTCTGAAGGAGGAAGG - Intergenic
1089626255 11:119752970-119752992 CTGTGAGCTCTGACTGTTGAGGG + Intergenic
1090183986 11:124724242-124724264 CAGTCAGCTCTGTCTGAGCAGGG + Intergenic
1091406972 12:215065-215087 CTGCCAGCTATCAATGGGGAAGG + Intergenic
1091611620 12:2015202-2015224 TTGTCAGCCCTAATTGAGGATGG - Intronic
1095631140 12:44378865-44378887 CTGTCATCTCTCAATCAGAAAGG - Intronic
1096536341 12:52277537-52277559 CCGCCAGCTCTGCAGGAGGAGGG + Intronic
1096812460 12:54180178-54180200 CTGTAAGATTTGACTGAGGATGG - Intronic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1101844959 12:108355941-108355963 CTGTGAGCTCTGAGTGAGCAGGG - Intergenic
1102548013 12:113670530-113670552 CTTTGAGCTTTGAGTGAGGATGG - Intergenic
1102953687 12:117046261-117046283 CTGTGAGCACTGACTGAGGCCGG + Intronic
1104072891 12:125361803-125361825 CTGTGAGCTCTGATGGAGGCTGG + Intronic
1106367412 13:29095402-29095424 CTGTCAACCCAGAATGAAGAGGG - Intronic
1106695165 13:32164952-32164974 CTGAGAGCTTTGAAAGAGGAGGG - Intronic
1107057063 13:36117872-36117894 CTTTCTCCTCTGAATTAGGATGG - Intronic
1108263614 13:48682140-48682162 GTGTCAGCTCTGGATGGGCAGGG - Intronic
1110797185 13:79652955-79652977 CTGTGAACTGTGAATGAGGAGGG + Intergenic
1111600450 13:90467509-90467531 CTCTCAGTTCTTAATGTGGAAGG + Intergenic
1113362359 13:109643238-109643260 CTTTCATCAGTGAATGAGGAAGG - Intergenic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1114810784 14:25896540-25896562 CTGTCAGATCTCAATGACGAGGG + Intergenic
1115283900 14:31696270-31696292 CTGTCATCTTTGGAAGAGGAAGG + Intronic
1118448729 14:65877270-65877292 CTGGCATGTATGAATGAGGAAGG - Intergenic
1118726480 14:68632575-68632597 AGGCCAGCTGTGAATGAGGAGGG + Intronic
1118774379 14:68964483-68964505 CTGTCAGCCCTGACTGGAGAAGG - Intronic
1119408003 14:74410759-74410781 CTGTCAGCTCTTACTGAGGGAGG + Intronic
1119896073 14:78220902-78220924 CTGTGGCATCTGAATGAGGAAGG + Intergenic
1120565844 14:86055730-86055752 CTGCCAGGTTTGATTGAGGATGG + Intergenic
1126235931 15:46384168-46384190 CTCTCAGCTGAGAATGAGTAAGG - Intergenic
1126361260 15:47848327-47848349 CTGTCTTCTCAGAATTAGGAAGG + Intergenic
1126475512 15:49061827-49061849 CTGCCAACTCTGATTAAGGATGG - Intergenic
1127260284 15:57322429-57322451 CTTTCAGCTGTCAATGAAGATGG + Intergenic
1127277616 15:57461128-57461150 CTGCCAGGTATTAATGAGGAAGG - Intronic
1128612760 15:69087254-69087276 CGATGAGCTTTGAATGAGGAAGG + Intergenic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1131507142 15:93029068-93029090 CTGTTGGCGCTGACTGAGGAGGG - Intergenic
1132733987 16:1376500-1376522 CTGCCAGCCATGAAGGAGGATGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133021358 16:2968300-2968322 CTGTGACCTCTCACTGAGGACGG - Exonic
1134191362 16:12123704-12123726 CCTTCAGCCCTGAATGAAGAAGG + Intronic
1138199807 16:55080273-55080295 CTGGGAGGTCTGAATGAGAATGG + Intergenic
1138940145 16:61780446-61780468 CTGTTATCTCTTAATGAGAATGG - Intronic
1140050946 16:71480498-71480520 CTGTCAGCAATGAGTGATGATGG - Intronic
1141355654 16:83344248-83344270 CTTTCAGATCTCAATGAAGAAGG - Intronic
1141515579 16:84542681-84542703 CGGTCAGCTCGGGATGAGGGTGG + Intronic
1141844179 16:86595894-86595916 CTGTCAGCTCTCACTGGGCAGGG - Intergenic
1142424493 16:89993973-89993995 CTGCCAGAACTGAATGAGAACGG - Intergenic
1143208957 17:5169016-5169038 ATGTTAGCGCTGAGTGAGGATGG - Exonic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1144401633 17:14908849-14908871 TTTTCAGGTCTGAATGAAGAGGG - Intergenic
1144618448 17:16798491-16798513 ATGTTAGCGCTGAGTGAGGATGG - Intronic
1144894258 17:18517202-18517224 ATGTTAGCGCTGAGTGAGGATGG + Intergenic
1145137973 17:20427040-20427062 ATGTTAGCGCTGAGTGAGGATGG - Intergenic
1145304673 17:21666914-21666936 CAGTTAGCTCTGAGTGAAGATGG - Intergenic
1148333116 17:46823891-46823913 CTGTCAGCGTTAAATGAGAATGG + Intronic
1148572012 17:48678013-48678035 CTCTCAGTTCTGAACAAGGAGGG + Intergenic
1148954980 17:51346077-51346099 CTGTAAGGACTGAATGTGGAAGG + Intergenic
1149871173 17:60183182-60183204 ATGTTAGCGCTGAGTGAGGATGG + Exonic
1150243235 17:63652865-63652887 CTATCTGCACTGAATGAGTAGGG - Intronic
1151121140 17:71794473-71794495 CTTTCAGCTCTGACTGAAAATGG + Intergenic
1153885163 18:9457969-9457991 CTGTCAGCTCTTACTGTGGAAGG + Intergenic
1159880830 18:73857142-73857164 CTGTTAGCTCTGCCAGAGGATGG - Intergenic
1160350489 18:78174302-78174324 CTGCGAGCTCTGAATGAGGGAGG + Intergenic
1160355108 18:78221179-78221201 CTGGCACCTGTGGATGAGGAGGG + Intergenic
1162000862 19:7744146-7744168 CTTTCAGATCTAAATCAGGAAGG - Exonic
1163398793 19:17079290-17079312 CAGTCAGTTCTTAATCAGGAGGG + Intronic
1163668365 19:18613470-18613492 CTGGTAGCTCTGAGTGGGGAGGG - Intronic
1165395880 19:35563363-35563385 TTGTGAGCTCTGACTGGGGAGGG - Exonic
1166470311 19:43074189-43074211 CTGTCAGGTCAGATTTAGGACGG + Intronic
1167798592 19:51726537-51726559 CTCTCGGGTCTGAAGGAGGAGGG - Intergenic
1168187674 19:54710053-54710075 GTGTCAGCTCAGAACGAGGTGGG + Intergenic
1168277353 19:55285123-55285145 CTTTCAGGTCTGAGGGAGGAGGG + Intronic
1168432717 19:56294057-56294079 CTGTCAGTGCAGCATGAGGACGG - Intronic
925532777 2:4883464-4883486 CTGTCAGCTATGGAGAAGGACGG + Intergenic
927376386 2:22419847-22419869 GTGTCAGCACCAAATGAGGATGG + Intergenic
931129004 2:59312000-59312022 CTGTAAGTTCTGAAGGAGCAGGG + Intergenic
931460601 2:62447255-62447277 CTGAGAGCTCTGCATCAGGATGG + Intergenic
932774936 2:74522708-74522730 CTGGCAGCCCTGGATGATGATGG - Exonic
933254391 2:80064151-80064173 ATGTCAGCTTAGAATGAGGAAGG - Intronic
935187017 2:100743792-100743814 CTTTCCACTCTGAATGGGGAAGG - Intergenic
937366494 2:121265817-121265839 GAGTCTGCTCTGAATGAGGAAGG - Intronic
938227420 2:129627855-129627877 CTGCCAGCACTGAATGTGGCTGG + Intergenic
938744226 2:134261710-134261732 ATGTAAGTTCTGAAAGAGGAGGG + Intronic
939077415 2:137620668-137620690 CTGTCAGCTCTCAGGGTGGACGG + Exonic
939804340 2:146754113-146754135 CTGTCACATCTGAATGACCAAGG + Intergenic
940246927 2:151628952-151628974 CTGCCATCTCTGAAAGAGGTGGG - Intronic
941472624 2:165907754-165907776 CTGTCAGCTCTCATGGAGGATGG - Exonic
942641605 2:178066726-178066748 CTGCCAGCTCTGGGTGAGGAGGG - Intronic
946134598 2:217635402-217635424 CTGTCAGCTCTTAAGAAGGCAGG + Intronic
1169352486 20:4880464-4880486 CTGTCAGCTCTGTGAGAGCAGGG - Intronic
1169900917 20:10550848-10550870 GTGACAGCTCTGCCTGAGGAAGG - Intronic
1170108617 20:12780181-12780203 ATGTCAGCTCTAAAAGAGCAGGG + Intergenic
1171522187 20:25784354-25784376 CAGTTAGCTCTGAGTGAAGATGG - Intronic
1171529937 20:25846299-25846321 CAGTTAGCTCTGAGTGAAGATGG - Intronic
1171554640 20:26071529-26071551 CAGTTAGCTCTGAGTGAAGATGG + Intergenic
1173489909 20:43471500-43471522 CTGTCAGCTCTGAAGATGGACGG + Intergenic
1173503479 20:43569759-43569781 TGGGCAACTCTGAATGAGGAAGG - Intronic
1173854527 20:46241481-46241503 CTGATAGCTCTGAATGCAGAGGG - Intronic
1175922211 20:62455564-62455586 CTGTCAGCTCTCCCTGAGGCGGG + Intergenic
1177709237 21:24749891-24749913 CCTTCAGCTCTTAAAGAGGAGGG + Intergenic
1178024216 21:28446788-28446810 CTTCCATCTCTGAGTGAGGAAGG + Intergenic
1181556301 22:23673545-23673567 CTGGCAGCCCTGAATGGGGGCGG - Intergenic
1182630055 22:31678192-31678214 CTATCAGCTGTGGATAAGGAAGG + Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1185080690 22:48707950-48707972 CTGGCCTCTCTGCATGAGGATGG - Intronic
949539450 3:5020663-5020685 GTGCCAGCTCTGACTGAGGTGGG - Intergenic
951902969 3:27675190-27675212 CTGTCAGGTCTAAATGAAAAAGG + Intergenic
951927215 3:27921615-27921637 CTGGCAGCTCTGCATGGGGGTGG + Intergenic
955398175 3:58572428-58572450 CTGACAGTTGAGAATGAGGAAGG + Intronic
955595111 3:60581077-60581099 CTTGCAGCTCTGAATGAATATGG + Intronic
956750776 3:72342242-72342264 CTGGCAGCTCTGCCTGAGGAGGG - Intergenic
957222093 3:77396696-77396718 CTGTCAACTGCCAATGAGGATGG + Intronic
960438780 3:117661117-117661139 TTGCCAGCTCTCAATGAGCAGGG - Intergenic
963765963 3:149336236-149336258 TTATCAGCTGAGAATGAGGATGG + Intergenic
964523306 3:157590149-157590171 CTGTCTGCTCTGAATTTGTAAGG - Intronic
966931081 3:184676081-184676103 AAATCAGCACTGAATGAGGAAGG - Intronic
967922590 3:194623930-194623952 ATGTCATCTCTGCCTGAGGAAGG - Intronic
969710937 4:8843045-8843067 CTGTCTCCTCTGAATGGTGAAGG + Intergenic
970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG + Intronic
972237772 4:37153919-37153941 CTGACAGCTGTGACTGAGTAGGG - Intergenic
972270018 4:37502184-37502206 CTGGCATGTGTGAATGAGGATGG - Intronic
973076159 4:45928889-45928911 CTCTCAGCTAGGAATGAGGTAGG + Intergenic
973663533 4:53133760-53133782 TTATCAACTGTGAATGAGGAAGG - Intronic
973788722 4:54358848-54358870 CTGTCACCTCTGCTTCAGGATGG - Intergenic
974404737 4:61451364-61451386 GAGTTAGCTCTGAATGAGGAAGG + Intronic
974686932 4:65242607-65242629 CTGCCAGCTCTGTAGGGGGATGG + Intergenic
975234196 4:71972301-71972323 GAGCCAGCTCTGAATGAGTAGGG + Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
978451376 4:108837834-108837856 TTGTCAGCCCTAAAAGAGGAAGG + Intronic
978479593 4:109174323-109174345 CTGTCAGGACAGAATGGGGAGGG - Intronic
978991962 4:115095087-115095109 CTGTAAGATTTGAATGAGGTGGG - Intronic
979542518 4:121901596-121901618 TTGTAAACTGTGAATGAGGAAGG + Intronic
980211905 4:129799804-129799826 CTACTAGCTCTGAATGAGAAGGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981766086 4:148251554-148251576 CATTCAGCTTTGTATGAGGAAGG + Intronic
982274691 4:153627252-153627274 CTGTCATCTCTGACTAGGGAAGG + Intronic
982274794 4:153627991-153628013 CTGTCATCTCTGACTAGGGAAGG - Intronic
983707200 4:170676093-170676115 CTGACAGCTGTGAAAGTGGAGGG - Intergenic
986428479 5:7657894-7657916 CAGACAGCTGTGACTGAGGAGGG + Intronic
988320035 5:29683212-29683234 CTCTCAGCTCTGAATGATATGGG - Intergenic
988798104 5:34671161-34671183 TTGTCAGCCCTAATTGAGGATGG + Intronic
991284305 5:64954156-64954178 CTGTGAACTCTGACTGAGAAGGG - Intronic
994707413 5:103223345-103223367 CTGTGAGCTTTAATTGAGGAAGG + Intergenic
996795680 5:127343850-127343872 AAGTCAGCTATGATTGAGGAAGG + Intronic
998624897 5:143835306-143835328 GTGTCAGCTCTGGATGATGTTGG + Intergenic
999133230 5:149300228-149300250 ATGCCAGCTGTGAAGGAGGAGGG - Intronic
1001329154 5:170750180-170750202 CTGTCAGTTCTGAAACAGAAGGG - Intergenic
1003383613 6:5647618-5647640 CTCTTACCTCTGAATGAAGAAGG - Intronic
1003992286 6:11498213-11498235 CTGTCACCTGTGAAAGGGGAGGG - Intergenic
1006987425 6:38185166-38185188 CAGCCAGCCCTGAAGGAGGAGGG - Intronic
1008445070 6:51579449-51579471 CTCCCAGCTCTGAAAAAGGAAGG + Intergenic
1009926323 6:70125396-70125418 CTCTGAGCTCGGAATGAGGAGGG - Intronic
1012071884 6:94631495-94631517 CCTACAGCACTGAATGAGGATGG - Intergenic
1013285774 6:108680084-108680106 CGGTGTGCTCTGAATGAGGGTGG - Exonic
1014394664 6:120911287-120911309 TTGTCATCTATGAATGAAGACGG + Intergenic
1016825463 6:148384701-148384723 CTGTCAGTCCTGAAAGAGCATGG + Intronic
1019413890 7:918813-918835 CTGTCTGCTCTGTAGGAGGTGGG - Intronic
1020382080 7:7557619-7557641 CTGTCATGTGTGAACGAGGATGG + Intergenic
1021915734 7:25430580-25430602 CTATCATCCCTGAATGAGGCAGG + Intergenic
1023005024 7:35855294-35855316 CAGTCAGCTATTAATGAAGATGG + Intronic
1023802746 7:43849178-43849200 CTGACAGCTGGGAAGGAGGAGGG + Intergenic
1024544234 7:50503432-50503454 CTAGGATCTCTGAATGAGGAAGG + Intronic
1025218346 7:57080403-57080425 CAGTCAGCTATTAATGAAGATGG - Intergenic
1025302040 7:57825888-57825910 CAGTTAGCTCTGAGTGAAGACGG + Intergenic
1025629265 7:63254022-63254044 CAGTCAGCTATTAATGAAGATGG - Intergenic
1025653000 7:63490058-63490080 CAGTCAGCTATTAATGAAGATGG + Intergenic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1026449976 7:70519828-70519850 CTGTCAGCTGGCCATGAGGAGGG + Intronic
1026587961 7:71672352-71672374 ATCTGATCTCTGAATGAGGAAGG + Intronic
1029197279 7:98814403-98814425 CAGGCAGCTCTGAAGAAGGATGG - Intergenic
1030164422 7:106539491-106539513 TTGTGGTCTCTGAATGAGGAGGG - Intergenic
1031550923 7:123110475-123110497 CTGTGAGCTTTGATTCAGGAAGG - Intergenic
1032712171 7:134469963-134469985 ATGTCAGCCCCAAATGAGGATGG - Intergenic
1033832507 7:145270903-145270925 ATGTCAGTTGTGAATCAGGAGGG + Intergenic
1035430485 7:158816440-158816462 CTGCCAGCTCTGAAGGGAGAAGG + Intronic
1035583374 8:754050-754072 CTGGCAGATCTGAGTGAGGATGG + Intergenic
1036610047 8:10341857-10341879 CAGTCAGCTGTTGATGAGGAAGG + Intronic
1038410787 8:27357612-27357634 TTGTCAACTCTGAATGAGAGAGG + Intronic
1038560274 8:28570977-28570999 CAGGCATCTCTGAATGAGAAAGG - Exonic
1039119609 8:34130932-34130954 CTGTCACCTCTGAATCTGGAAGG + Intergenic
1039548800 8:38428914-38428936 CTATCTGCTCTGATTAAGGAGGG - Intronic
1040087753 8:43364026-43364048 CTGGGAGCTCTGACTCAGGAAGG - Intergenic
1040108431 8:43553825-43553847 CTGACAGCTCTAAAGGTGGATGG - Intergenic
1040937146 8:52793265-52793287 GTGTCAACTCTGAAGGAGGATGG + Intergenic
1041021647 8:53644062-53644084 CAGGCAGCTAAGAATGAGGAAGG - Intergenic
1041382623 8:57266832-57266854 CTGTCAGCTCTGCAGAAGCAGGG - Intergenic
1041647893 8:60272323-60272345 CTGGCAGCACTGAATGAGATGGG - Intronic
1041938553 8:63361257-63361279 CTGTCACCACTGAACGTGGATGG + Intergenic
1042326029 8:67528673-67528695 ATGCCAGCTCAGACTGAGGATGG - Intronic
1043103328 8:76075174-76075196 CTGCTAGCTTTGAAGGAGGAGGG + Intergenic
1043342173 8:79253035-79253057 CCATCAGCTGTTAATGAGGATGG + Intergenic
1044722441 8:95164048-95164070 ATGTCAGCTCTGAAGGAGGGAGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1047446812 8:124927340-124927362 CTGACACCGCTGAAGGAGGACGG - Intergenic
1048423186 8:134297303-134297325 CTGTGAGCCCGGAATGAGCATGG + Intergenic
1048431609 8:134376432-134376454 GTGCCAGCTCTTAATAAGGAGGG - Intergenic
1049488767 8:142879998-142880020 CTCTCAGCCCTGGAGGAGGAGGG - Intronic
1051029759 9:12659120-12659142 CTGTCAGCTCTGAAGGGGGCAGG + Intergenic
1051030690 9:12672881-12672903 CTGTCTGCTCTGTATGAAGGTGG + Intergenic
1052874958 9:33551851-33551873 CTGTCAGGTCTGAATGAATGAGG - Intronic
1054907378 9:70422689-70422711 TTCTCAGCTCAGAGTGAGGAAGG - Intergenic
1055113291 9:72580934-72580956 CTGAAACCTCTGACTGAGGATGG - Intronic
1055686347 9:78779180-78779202 TGGGCAGCTCTGAATGATGAAGG + Intergenic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1057269338 9:93639890-93639912 CTCTGAGCTCTGAATGTGAATGG + Intronic
1058314366 9:103546250-103546272 CTGTTAGCTCTAAATTCGGAGGG + Intergenic
1058950609 9:109900405-109900427 CTGTCAGATCTGTAAGAGCAAGG - Intronic
1062214461 9:135381653-135381675 CTGTCAGATTTGAATGGGGCAGG - Intergenic
1186068708 X:5794196-5794218 GAGTCAGCTCAGAATTAGGAAGG + Intergenic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1186647876 X:11526345-11526367 CTGTCAGCTGTACATGAGTAGGG + Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189709099 X:43790939-43790961 CAGTCTTCTCTGAATGAGCATGG - Intronic
1190261523 X:48800792-48800814 ATGTCAGCTCTGCAGGAGGCCGG - Intergenic
1190738662 X:53272920-53272942 CTGTCAGCTCTAGAAGAGGAGGG - Intronic
1191642439 X:63441900-63441922 CTGGCATATGTGAATGAGGAAGG + Intergenic
1192934744 X:75848156-75848178 CTGACAAGTGTGAATGAGGATGG - Intergenic
1195323192 X:103737576-103737598 CTCTCAGCTCTGATTTAAGAAGG - Intergenic
1196143560 X:112292215-112292237 TTTTCAGCTCTGAAGGAGGTGGG - Intergenic
1196584169 X:117409814-117409836 CTGACATGTGTGAATGAGGATGG + Intergenic
1197314221 X:124944470-124944492 CTTTCAGCTCTGAGTGAGAATGG - Intronic
1198479344 X:137026882-137026904 CTGTCAGCTCTGGGTTGGGAAGG + Intergenic
1198730476 X:139722550-139722572 CTGGCAGTTCTGAAAGAGGAAGG + Intergenic
1199907853 X:152252905-152252927 GTGTCAGCTCTGAGAGAGGATGG - Intronic
1201066381 Y:10099536-10099558 CTCTCAGGTCTGAATGTGGATGG + Intergenic