ID: 1101604690

View in Genome Browser
Species Human (GRCh38)
Location 12:106239377-106239399
Sequence CGTCACCGTAGAGCACCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101604687_1101604690 -6 Left 1101604687 12:106239360-106239382 CCTCTTCAGCTCCTCCACGTCAC 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 53
1101604685_1101604690 2 Left 1101604685 12:106239352-106239374 CCCACACTCCTCTTCAGCTCCTC 0: 1
1: 0
2: 1
3: 44
4: 439
Right 1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 53
1101604684_1101604690 22 Left 1101604684 12:106239332-106239354 CCACGGTGCTGGGGAGCTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 53
1101604686_1101604690 1 Left 1101604686 12:106239353-106239375 CCACACTCCTCTTCAGCTCCTCC 0: 1
1: 0
2: 4
3: 92
4: 891
Right 1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101604690 Original CRISPR CGTCACCGTAGAGCACCAGC TGG Exonic
900159890 1:1218559-1218581 GGGCACCGTGGAGAACCAGCAGG - Exonic
907742918 1:57184585-57184607 CGTCACCGTGTAGAATCAGCTGG - Intronic
917853311 1:179082883-179082905 CATCACTGTAGAGCACCGGATGG + Intronic
1065821845 10:29532893-29532915 AGTCACCTTAGAGCATCAGAAGG - Exonic
1076547485 10:131254959-131254981 CGTCAACCTAGAGCTCCAGGAGG + Intronic
1077414020 11:2416160-2416182 CGCCACCTCTGAGCACCAGCAGG + Intronic
1080751161 11:35151660-35151682 CATCACCGTAGTGGAGCAGCAGG + Intronic
1086575755 11:88337615-88337637 CGTCGCCGGAGAGAAGCAGCAGG + Exonic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1097895894 12:64824724-64824746 CGTGACCCTCCAGCACCAGCCGG + Exonic
1100618171 12:96247638-96247660 CGGTGCCGGAGAGCACCAGCGGG - Exonic
1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG + Exonic
1102150941 12:110688937-110688959 CCTCGCCGTGGAGCCCCAGCAGG - Intronic
1117066227 14:52015207-52015229 TGCCACCGTAGTGCTCCAGCAGG + Exonic
1118492400 14:66273822-66273844 AGTCACTGGGGAGCACCAGCAGG + Intergenic
1122523403 14:102362975-102362997 CAGCACCGAAGAGCAGCAGCTGG - Exonic
1123710272 15:22981196-22981218 CCTTACCGCAGAGCACAAGCGGG - Intergenic
1125095243 15:35842849-35842871 GGTCACAGTAGAGAAGCAGCAGG + Intergenic
1130224223 15:82045558-82045580 CGTCACTGTCCAGCCCCAGCAGG + Exonic
1132813670 16:1815574-1815596 GGTCACAGCAGAGCAACAGCTGG + Intronic
1138660196 16:58512125-58512147 CGTGGCCCTACAGCACCAGCTGG - Exonic
1152780969 17:82227297-82227319 CCCCACCGTAGAGCAGCAACAGG - Intergenic
1160732911 19:649276-649298 CCTCACAGTAGCCCACCAGCCGG - Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
926113022 2:10194726-10194748 TGCCCCCGTAGAGCCCCAGCAGG - Intronic
934611044 2:95736719-95736741 AGACACCGCAGAGTACCAGCAGG - Intergenic
936544385 2:113378294-113378316 AGACACCGCAGAGTACCAGCAGG - Intergenic
938908499 2:135862701-135862723 CGCCACCAAAGAGCATCAGCAGG + Exonic
939990650 2:148875146-148875168 CGTCACCGTAGAGGTCCGCCCGG - Intergenic
948060738 2:235041855-235041877 TGTCACTGTTGAGCTCCAGCGGG - Exonic
1169968915 20:11247756-11247778 TGTCACCGTAGCACACCAGATGG - Intergenic
1172033052 20:31995230-31995252 CGCCACCGCGGTGCACCAGCAGG - Exonic
1172038862 20:32029795-32029817 GGTCTCCGTAGAGCTTCAGCAGG - Exonic
1178938865 21:36888150-36888172 CCTCACAGTAGAGAAACAGCCGG - Intronic
1181006134 22:20014587-20014609 CAGCACTGCAGAGCACCAGCTGG - Intronic
1184477548 22:44729731-44729753 CGTCACCGTGTGGCTCCAGCTGG + Intronic
1184960076 22:47922243-47922265 TGGCACAGTAGAGCAGCAGCTGG - Intergenic
961537693 3:127580035-127580057 TGTCTTCGTAGAGCAGCAGCAGG + Exonic
971252029 4:24980945-24980967 CATCACCGCAGAGCACCATGCGG - Intergenic
980830303 4:138123602-138123624 CCACACAGGAGAGCACCAGCAGG + Intergenic
984653059 4:182289996-182290018 CAGCACCGTAGGGCACGAGCGGG - Intronic
985543898 5:499801-499823 CGTCTCCGTAGATCAGCAGAAGG + Intronic
999266561 5:150270527-150270549 AGTCACCCAGGAGCACCAGCAGG + Intronic
1001515143 5:172350372-172350394 CGTCACCGTCGGGCACCGGGCGG + Exonic
1003923131 6:10852512-10852534 TGTCAACGTAAAGCAACAGCTGG - Intronic
1013582699 6:111551864-111551886 CCTCATCGTCGAGCAGCAGCTGG - Intergenic
1023580703 7:41679865-41679887 CCTCTCTGTAGATCACCAGCCGG + Intergenic
1036772030 8:11585764-11585786 CTTCACAGTACAGCACCTGCAGG + Intergenic
1039062808 8:33585201-33585223 CTTCAAAGTAGAGAACCAGCTGG - Intergenic
1041099229 8:54379734-54379756 GGTCACCGGAGAGCATCAGTGGG + Intergenic
1055902500 9:81257380-81257402 TGACACCGTAAAGCACCACCTGG + Intergenic
1059216896 9:112572941-112572963 CCTGACTGCAGAGCACCAGCGGG + Intronic
1061627512 9:131849744-131849766 GGTCACCGCTGAGGACCAGCAGG + Intergenic
1198312651 X:135436760-135436782 CGGCACCGAAAAGCAGCAGCTGG + Intergenic