ID: 1101605152

View in Genome Browser
Species Human (GRCh38)
Location 12:106242839-106242861
Sequence CTGTCAGCCCTGACCTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101605147_1101605152 9 Left 1101605147 12:106242807-106242829 CCTGATGAGCTGGTCCATGTCTC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1101605152 12:106242839-106242861 CTGTCAGCCCTGACCTGCGCTGG 0: 1
1: 1
2: 0
3: 26
4: 205
1101605148_1101605152 -5 Left 1101605148 12:106242821-106242843 CCATGTCTCCTCTGATCCCTGTC 0: 1
1: 0
2: 1
3: 57
4: 477
Right 1101605152 12:106242839-106242861 CTGTCAGCCCTGACCTGCGCTGG 0: 1
1: 1
2: 0
3: 26
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101605152 Original CRISPR CTGTCAGCCCTGACCTGCGC TGG Intronic
900612058 1:3548422-3548444 CTGTCAGCACAGCCCTGCGGAGG + Intronic
901070089 1:6512673-6512695 CCATCAGCCCTGCCCTGCGCTGG + Intronic
901227404 1:7621760-7621782 CTGGCACCCCCGACCTGCTCGGG - Intronic
901689898 1:10965908-10965930 CTGACAGCCCTCACTTGCACAGG - Intronic
905029293 1:34870717-34870739 GTGTCTGCCCTGTCCTGCCCTGG + Intronic
906212410 1:44019576-44019598 CTGGCTGCCCTGGCCTGGGCCGG + Intronic
906782738 1:48586899-48586921 GTCTCAGCCCTTACCTGAGCTGG + Intronic
909542037 1:76802201-76802223 CTGTCAGCTCTGGCCTGCAGAGG - Intergenic
911522218 1:98942881-98942903 CCATCAGCCCTGACCTGCAGAGG - Intronic
912458865 1:109818156-109818178 CTGGCAGCTCTGACCTGGACAGG + Intergenic
913958723 1:143323560-143323582 CTCTCGGCCCTGTCCTGCTCTGG - Intergenic
914053040 1:144148940-144148962 CTCTCGGCCCTGTCCTGCTCTGG - Intergenic
914126157 1:144817601-144817623 CTCTCGGCCCTGTCCTGCTCTGG + Intergenic
915327546 1:155088421-155088443 CTGTAAACCCTGACCTTCTCTGG - Intergenic
915647429 1:157283633-157283655 CTGTTATCCCTGACATGGGCAGG + Intergenic
918001656 1:180502662-180502684 CTGTGAGGCCTGCTCTGCGCCGG + Exonic
918480354 1:184971205-184971227 CTGTGAGCCTTGACCTCCCCTGG - Intronic
920723471 1:208411784-208411806 CTGTCAGCCCTGGGCTGCCATGG + Intergenic
923005943 1:230049995-230050017 CTGTCAGCCCAGACCTGTTGGGG - Intergenic
923141289 1:231162936-231162958 CTGCCAGCGCTGCTCTGCGCTGG - Intronic
923856370 1:237849539-237849561 CTCTGACCCCTCACCTGCGCTGG + Intergenic
924261645 1:242237638-242237660 CTTGCAGCCCTGGCCTGGGCTGG + Intronic
924819980 1:247479788-247479810 CTGTTGGCCCTGAGCTGTGCTGG + Intergenic
1063676040 10:8141275-8141297 CTGTCAGCCCCGCCCTGCCCCGG - Intergenic
1069334164 10:67328409-67328431 CTGTCAGTCCTGAACTCTGCAGG - Intronic
1069918590 10:71802409-71802431 CTGTAAGACCTGCCCTGGGCTGG + Intronic
1071087183 10:81876701-81876723 CCAGCAGCCCTGACCTGGGCAGG + Intronic
1071499541 10:86193591-86193613 CTGTCAGAGTTGACCTGAGCTGG - Intronic
1073998102 10:109339257-109339279 CAGTAGGCCCTGAGCTGCGCTGG + Intergenic
1075612959 10:123868124-123868146 CTGTCAGCCCCACCCTGGGCTGG + Intronic
1076251343 10:128986181-128986203 CCATCAGCCATGACCTGAGCTGG + Intergenic
1076501304 10:130938287-130938309 CGGCCAGCCCTCACCTGCACTGG + Intergenic
1077402982 11:2368136-2368158 CTGTCAGCCGTGACCAGAGCTGG - Intergenic
1077474306 11:2779113-2779135 CTGTCAGCACAGACCTGAGCAGG + Intronic
1081383842 11:42447656-42447678 CTGTCAGCTAGGACCTGAGCAGG + Intergenic
1081852735 11:46285083-46285105 CTGTCTGCCCTGGCCTGGCCTGG + Intronic
1083157514 11:60833732-60833754 CTGTCAGCCAGGACCTCAGCTGG + Intergenic
1083335078 11:61917476-61917498 CTGTCAGCCCTGCCCGCGGCCGG + Exonic
1083618263 11:64036722-64036744 CCGTCAGCCCTGAGCCGGGCGGG + Intronic
1084211845 11:67628031-67628053 CTGGCCGGCCTGACCTGCTCAGG - Exonic
1084370039 11:68735280-68735302 CTCTCAGACCTGCCCTGAGCTGG + Intronic
1084706483 11:70818989-70819011 CTGACATCCCTGACCTTAGCTGG + Intronic
1086371083 11:86156476-86156498 CTGTCTGCCCTCACCTGCTAGGG + Intergenic
1086462873 11:87022972-87022994 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1088945057 11:114503832-114503854 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1090086452 11:123654593-123654615 CTGTCAGCCCTGACATGCGCAGG + Exonic
1091544778 12:1494288-1494310 CTGCCAGCCCTGGGCTGCTCAGG + Exonic
1091850541 12:3693411-3693433 CTGTCAGACCTGAACTCTGCAGG - Intronic
1095542791 12:43330197-43330219 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1096258220 12:50075399-50075421 CTAGCAGCCCTGTCTTGCGCCGG - Intronic
1096574481 12:52544256-52544278 CTGGCAGCCAGGACCTGGGCTGG + Exonic
1096706731 12:53426545-53426567 CTGCCAGCCTTGACCTCCCCAGG - Intronic
1097169550 12:57105208-57105230 ATGTCGGCCCTGACCAGCGGAGG + Exonic
1099016051 12:77345474-77345496 CTGACATCCCTGACCTGCCATGG - Intergenic
1099732841 12:86526659-86526681 CTGTCAGACCTGAACTCTGCAGG - Intronic
1101605152 12:106242839-106242861 CTGTCAGCCCTGACCTGCGCTGG + Intronic
1104590691 12:130082230-130082252 ATGGCAGCCCTGCCCTGGGCTGG + Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1113884834 13:113653089-113653111 CTGCCAGCCCTGTCCTGCCCTGG + Intronic
1117135407 14:52730361-52730383 CTGTCAGCCCTCCGCTCCGCCGG + Exonic
1118298261 14:64590516-64590538 CTTTCAGGCCTGACCTTCTCAGG - Intergenic
1118774379 14:68964483-68964505 CTGTCAGCCCTGACTGGAGAAGG - Intronic
1122941819 14:104984911-104984933 CCGTCAGCCCTGCTCTGCCCGGG + Intergenic
1123422616 15:20144600-20144622 CTCTCGGCCCTGTCCTGCTCTGG - Intergenic
1123531843 15:21151140-21151162 CTCTCGGCCCTGTCCTGCTCTGG - Intergenic
1124621609 15:31277236-31277258 CTGTCAGCCCTGACCCTCAGAGG + Intergenic
1126517938 15:49556717-49556739 CTGTCAGACCTGAACAGAGCAGG - Intronic
1127054285 15:55115865-55115887 CTGTCAGCCATGACCCACGATGG - Intergenic
1127188624 15:56506512-56506534 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1128237053 15:66075282-66075304 CTGTAAGCCCAGATCTGTGCTGG - Intronic
1130086832 15:80784620-80784642 CTATCAGCCAGGACCTGGGCAGG + Intronic
1131507092 15:93028741-93028763 TTGCCAGCCCTGGCCCGCGCTGG + Intergenic
1132273160 15:100544343-100544365 CTCTGGGCCTTGACCTGCGCGGG + Intronic
1132273170 15:100544378-100544400 CTCTCGGCCTTGACCTCCGCGGG + Intronic
1132273181 15:100544413-100544435 CTCTCGGCCTTGACCTGCGCGGG + Intronic
1133788278 16:8989646-8989668 CTTTCAGTCCTGACATGGGCAGG + Intergenic
1133999128 16:10768976-10768998 TTGACAGCCCTGTCCTGTGCTGG - Exonic
1136344383 16:29665446-29665468 GTGCCAGCCCTGCCCTGCCCAGG - Exonic
1136862135 16:33710748-33710770 CTCTCGGCCCTGTCCTGCTCTGG + Intergenic
1138776410 16:59729233-59729255 CTGTCAGACCTGAACTGAGCAGG + Intronic
1138976528 16:62214471-62214493 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1139513561 16:67440703-67440725 CTGTGAGCCCAGGCCTGCCCTGG + Intronic
1139649720 16:68356250-68356272 CGGGCAGCCCTGTCCTGCTCCGG + Intronic
1142233965 16:88912742-88912764 CTGGCAGCCCTGTCCTCTGCAGG + Intronic
1203123630 16_KI270728v1_random:1558931-1558953 CTCTCGGCCCTGTCCTGCTCTGG + Intergenic
1145023964 17:19453630-19453652 CTGTCAACCCTGGCCTGCTTTGG - Intergenic
1146159488 17:30552338-30552360 CTCTCAGCCCTGCCCTGTGCTGG + Intergenic
1148618049 17:49014649-49014671 CTGCCAACCATGACCTGCGGTGG - Intronic
1150234241 17:63579792-63579814 CCGTCAGCCCTGACTTGCACTGG + Intronic
1151440200 17:74123689-74123711 CTGTCACCTCTGACCTCAGCTGG + Intergenic
1151547142 17:74800103-74800125 CTCTCAGCTCTGTCCTGCCCTGG + Intronic
1152345526 17:79748461-79748483 CGGGCACCCCTGACCTGGGCGGG - Intergenic
1152645752 17:81467844-81467866 CTGTCTGCCCTGCCCTGCCCTGG - Intergenic
1152758545 17:82097202-82097224 CTGGCACCCTTCACCTGCGCGGG + Intronic
1154415727 18:14174309-14174331 GTCTCAGCCCTGCCCTGCTCTGG - Intergenic
1157364197 18:47048566-47048588 AAGTCAGCCCTGCCCTGCTCCGG - Intronic
1157559953 18:48638958-48638980 CCATCACCCCTGACCTGCGGTGG + Intronic
1160505196 18:79422977-79422999 CTATCTGCCCTGCCCTGCCCCGG - Intronic
1162829819 19:13277454-13277476 CAGTCAGCCCTGAACTTCTCTGG - Intronic
1163662626 19:18587949-18587971 CTGTCACCCCATACCTGAGCTGG + Intronic
1164643566 19:29843281-29843303 CTGTCAGCCCGGACTGGCGGCGG - Intergenic
1164704242 19:30308128-30308150 GTGTCAGCCCTCACCTGTGGAGG + Intronic
1166858432 19:45795136-45795158 CTGTCAGCCCACCCCTGTGCTGG - Intergenic
1167135082 19:47610804-47610826 TTGTCAACTCTGACCTGCCCTGG + Intronic
1202692436 1_KI270712v1_random:101363-101385 CTCTCGGCCCTGTCCTGCTCTGG - Intergenic
925749876 2:7078465-7078487 CTCTCAGCCCTGGCCTGAGTTGG - Intergenic
925750968 2:7090315-7090337 CCGTGAGCCCTGCCCTGCTCCGG - Intergenic
926060379 2:9801247-9801269 CTGTCAGCCGTGAGCTCTGCTGG - Intergenic
926165238 2:10518847-10518869 CTCTCTGCCCTGACCTCGGCTGG - Intergenic
926692573 2:15747751-15747773 GGGTCTGCCCTGACCTGCCCAGG - Intergenic
927712980 2:25337023-25337045 CTGTAAGCCATGCCCTGTGCTGG - Intronic
927809276 2:26172900-26172922 CTGTCCGCCCTGCCCCGCCCCGG - Intergenic
928378976 2:30802097-30802119 CTCTCAGGCCTGACCTGTGGAGG + Intronic
929381958 2:41364577-41364599 CTGTCAGACCTGAACTCTGCAGG + Intergenic
929620451 2:43349125-43349147 CTGTCAGCCCTGCCCTGAGGAGG + Intronic
930963583 2:57291404-57291426 CTGTCAGGCTTAACCTGAGCTGG + Intergenic
931557180 2:63518653-63518675 CTGTCAGACCTGAACAGTGCAGG + Intronic
931643459 2:64401137-64401159 CTGTCAGCGCTCACCTGCATGGG + Intergenic
933953962 2:87352608-87352630 CTCTCGGCCCTGTCCTGCTCTGG + Intergenic
934238164 2:90248851-90248873 CTCTCGGCCCTGTCCTGCTCTGG + Intergenic
934275034 2:91567882-91567904 CTCTCGGCCCTGTCCTGCTCTGG - Intergenic
934460578 2:94212190-94212212 CTCTCGGCCCTGTCCTGCTCTGG + Intergenic
935062939 2:99623747-99623769 CTGTGAGCCCTGTCCTGACCTGG + Intronic
938067896 2:128291912-128291934 CTGTCAGCCCTGAGCAGGGAGGG - Intronic
938274518 2:130006118-130006140 CTGGCAGCCGCGACGTGCGCTGG - Intergenic
938297628 2:130188302-130188324 CTGTCTGGCCTGGCCTGCGGAGG + Intronic
939184169 2:138841038-138841060 CTGTCTTCCCTGCCCTGTGCAGG + Intergenic
940403091 2:153268859-153268881 CTTTCAGCCATCACCTGAGCTGG + Intergenic
944052780 2:195490263-195490285 CTGTCAGCCCTGGCCTACAGAGG + Intergenic
946103791 2:217351763-217351785 CTGTCAGACCTGAACTGTGAGGG - Intronic
946662760 2:222018991-222019013 CTGTCAGCCCAGGCCTGCAGGGG - Intergenic
947625684 2:231616810-231616832 CTGTCCTCCCTGACCAGGGCCGG + Intergenic
948237582 2:236402107-236402129 CTGCCAGCCCTGAGCTGGGGAGG - Intronic
948777528 2:240297451-240297473 CTGTGAGCCCTGAGCAGGGCTGG + Intergenic
1172361331 20:34314695-34314717 CTCTCTGCTCTGACCTGCCCTGG - Intergenic
1174419030 20:50387431-50387453 CTTTCTGCCCTGACCGTCGCTGG + Intergenic
1176181152 20:63750074-63750096 CTGTCAGCCCTTCCCTGGCCTGG - Intronic
1178314687 21:31558567-31558589 AGGTCAGCGCTGACCTGCGGCGG - Intronic
1179612367 21:42560490-42560512 CTTCCAGCCCTGACCTGCTGAGG - Intronic
1179960039 21:44762935-44762957 GTGTCAGCCCTGACTTGCTATGG - Intergenic
1180203281 21:46240175-46240197 CAGTCAGCCCTTCCCTGGGCTGG - Intronic
1180948712 22:19710739-19710761 CGGGCAACCCTGACCTGTGCTGG - Intergenic
1185338594 22:50281800-50281822 CTCTCAGCCCAGACCCGAGCAGG + Intronic
1185364555 22:50431442-50431464 ATGTCAGCGCTGACGTGTGCCGG + Intronic
1185417356 22:50717562-50717584 CTCACAGCCCTGCCCTGCACAGG + Intergenic
950426361 3:12926739-12926761 CTGTCAGCCAGGAACTGTGCAGG - Intronic
952750025 3:36817489-36817511 CTGACAGCCCTGACCTGACTTGG + Intergenic
959421542 3:106135479-106135501 CTGTCAGACCTGAACTCTGCAGG + Intergenic
959433572 3:106284933-106284955 CTGTCAGACCTGAACTTTGCAGG + Intergenic
961626961 3:128270817-128270839 ATGTGAGCCCTGAGCTGTGCTGG - Intronic
962319132 3:134376532-134376554 CTGTCAGGCATGGCCTGCGGTGG + Intergenic
962561296 3:136609224-136609246 CTGCCTGCCCTGACCTCTGCTGG - Intronic
962873701 3:139519620-139519642 CTGTGAGCCCTGCCATGTGCTGG + Intronic
970101150 4:12524232-12524254 CTGTCAGACCTGATCTCTGCAGG + Intergenic
971227225 4:24765836-24765858 CTGTCAGCTCTGAGCTCAGCTGG + Intergenic
972626522 4:40804883-40804905 CTGTCAGCCCTGGCCTGCAGAGG + Intronic
976068339 4:81215048-81215070 CTGGCTGAGCTGACCTGCGCTGG - Exonic
979216877 4:118175757-118175779 CTCTCAGCCTGGACCTGTGCTGG + Intronic
981511818 4:145566208-145566230 CTGTCAGGCCTGAACTCTGCAGG + Intergenic
985073937 4:186193996-186194018 CTGTCAGACCAGACCAGGGCAGG + Intronic
986707029 5:10460759-10460781 CTGCCAGCCCTGCCCTCTGCAGG + Intronic
987887654 5:23831883-23831905 CTGTCAGACCTGATCTTTGCAGG + Intergenic
990893293 5:60671141-60671163 CTGTCAGCCATCACCTTGGCAGG - Intronic
991256590 5:64621191-64621213 CTATCAGCCCTGTCCTACACAGG + Intergenic
991577672 5:68122134-68122156 CTGTCAGACCTGATCTCTGCAGG + Intergenic
991635394 5:68699362-68699384 CTGTCATCCCTGGCCTGCAGAGG - Intergenic
995954954 5:117766531-117766553 CCTTCAGCCCTGACCTTGGCTGG + Intergenic
996954304 5:129164557-129164579 CTGTCAGACCTGAACTCTGCAGG - Intergenic
998719098 5:144922913-144922935 CTGATAGCCCTGCCCAGCGCAGG - Intergenic
999102418 5:149037429-149037451 CTGTAAGCCCTGCCCTTCGTGGG - Intronic
999373385 5:151069658-151069680 CTGGCAGCCCTCACCTCTGCTGG - Intronic
1001791802 5:174464085-174464107 CCGTCAGCCCTGCTCTGCACAGG - Intergenic
1003016741 6:2474077-2474099 CTGTCTGTCCTGAACAGCGCTGG + Intergenic
1006433951 6:34016315-34016337 CTGTCAGCCCCCACCAGGGCAGG - Intergenic
1007081357 6:39107294-39107316 CTGTCAGCCCTGACCTCCCTGGG + Intronic
1007507834 6:42350135-42350157 CTGACTGCACTGACCTGCGTCGG - Intronic
1007521180 6:42452612-42452634 CTGTCAGCCCTGAGGTGCAGCGG + Intergenic
1011538434 6:88403704-88403726 CTGTCATCCTTGACCTGCTGAGG + Intergenic
1014098186 6:117482610-117482632 CTTTCAGCCCAGCCCTGCGGGGG - Intronic
1015213548 6:130723740-130723762 CTGCCAGCCTTCACCTGAGCTGG + Intergenic
1019476326 7:1246437-1246459 CTGCCCGCCCTGCCCGGCGCTGG - Intergenic
1019538078 7:1539100-1539122 CTGCCGGCCCTGACCTGTGCTGG + Intronic
1019540859 7:1550422-1550444 CTGTGAGCCCTGAGCTGCACCGG + Intronic
1020736080 7:11950552-11950574 CTGTCAGACCTGACCTCTGCTGG - Intergenic
1025141670 7:56471955-56471977 CTGTCACCCCAGACCAGCGCTGG + Intergenic
1025707761 7:63883078-63883100 CTGTCACCCCAGACCAGCGCTGG + Intergenic
1025957860 7:66196486-66196508 CAGTCAGTCCTGGTCTGCGCTGG + Intergenic
1029420503 7:100469523-100469545 CTCTCAGGCCCCACCTGCGCAGG + Intronic
1030089898 7:105849362-105849384 CTGACAGACCTGAGATGCGCAGG + Intronic
1030143404 7:106328371-106328393 ATCTCAGCCCTGACCTGCAAGGG + Intergenic
1032080805 7:128857554-128857576 CCTTCAGCTCTGGCCTGCGCTGG + Intronic
1032091448 7:128913606-128913628 CCTTCAGCTCTGGCCTGCGCTGG - Intergenic
1032999927 7:137492756-137492778 CTGTCAGACCTGAACAGAGCAGG + Intronic
1035290873 7:157837666-157837688 ATGTGAGCCCTGCCCTGCGGGGG - Intronic
1037373644 8:18205928-18205950 CTGTCAGTCCTGAACTCTGCAGG - Intronic
1039264374 8:35808808-35808830 CTGTCAGACCTGAACTCTGCAGG + Intergenic
1040540258 8:48347503-48347525 CTGTCAGGCCTGAACTTTGCAGG + Intergenic
1044313723 8:90726292-90726314 CTGTCAGACCTGAACTCTGCAGG + Intronic
1048727236 8:137400491-137400513 CTGTCAGACCTGAACAGAGCAGG + Intergenic
1049309572 8:141926472-141926494 ATGACAGCCCTGAGCTACGCAGG - Intergenic
1053543008 9:38993991-38994013 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1053691077 9:40587887-40587909 CTCTCAGCCCTGTCCTGCTCTGG + Intergenic
1053807451 9:41817508-41817530 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1054273728 9:63049604-63049626 CTCTCAGCCCTGTCCTGCTCTGG - Intergenic
1054302336 9:63388858-63388880 CTCTCAGCCCTGTCCTGCTCTGG + Intergenic
1054401112 9:64715364-64715386 CTCTCAGCCCTGTCCTGCTCTGG + Intergenic
1054434717 9:65199678-65199700 CTCTCAGCCCTGTCCTGCTCTGG + Intergenic
1054495672 9:65822003-65822025 CTCTCAGCCCTGTCCTGCTCTGG - Intergenic
1054623141 9:67369919-67369941 CTGTCAGACCTGAACTCTGCAGG + Intergenic
1056808468 9:89746181-89746203 CTGTCAGGCCAGACCTGGGGAGG - Intergenic
1057271990 9:93656652-93656674 CAGTCAGCCCTGACCAGGTCTGG - Intronic
1057623296 9:96655313-96655335 CTGTCAGCGCGGACCGGGGCGGG + Intergenic
1058157735 9:101533869-101533891 CTCTCACCCCTGACCCGCGGCGG - Exonic
1060749047 9:126156693-126156715 CTTTCAGCCCAGACGTGTGCAGG - Intergenic
1061321803 9:129835559-129835581 CTGTCAGCCCGGAGCCGGGCTGG - Intronic
1061340065 9:129973056-129973078 CTGGCAGCCCTGCCCTAGGCAGG - Intronic
1062419017 9:136470188-136470210 CCTTCAGCCCTGGCTTGCGCAGG - Intronic
1186858913 X:13652266-13652288 CTGACAGCTCTGAGCTGCCCCGG + Intergenic
1189155043 X:38748416-38748438 CTTTCTGCCCTGACCTCCTCAGG - Intergenic
1190524140 X:51311201-51311223 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1193061639 X:77214003-77214025 CTGTCAGACCTGATCTCTGCAGG - Intergenic
1193703355 X:84790875-84790897 CTGTCAGACCTGAACTCCGCAGG + Intergenic
1194055530 X:89127408-89127430 CTGTCAGACCTGATCTCTGCAGG - Intergenic
1194323602 X:92481636-92481658 CTGTCAGACCTGAACTCTGCAGG - Intronic
1194549114 X:95274169-95274191 CTGTCAGACCTGATCTCTGCAGG + Intergenic
1195361104 X:104084603-104084625 CTGTCTGACCTGATCTGTGCTGG - Intergenic
1197790378 X:130248578-130248600 CTGTCAGACCTGAACTCTGCAGG + Intronic
1198891674 X:141403539-141403561 CTGTCAGACCTGAACTCTGCAGG - Intergenic
1199686356 X:150268994-150269016 CAGTCAGCCCTGTCCTGTGCTGG - Intergenic
1200631703 Y:5594798-5594820 CTGTCAGGCCTGAACTCTGCAGG - Intronic
1201189771 Y:11436553-11436575 GTCTCAGCCCTGTCCTGCTCTGG + Intergenic
1201395067 Y:13539206-13539228 CTGTCAGGGCTGACCTCTGCAGG + Intergenic
1202583861 Y:26405385-26405407 CTCTCAGCCCCGTCCTGCTCTGG - Intergenic