ID: 1101606170

View in Genome Browser
Species Human (GRCh38)
Location 12:106248467-106248489
Sequence AGGGGGTCGCGCTTGGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101606170_1101606185 16 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606185 12:106248506-106248528 CGGAGAGGAGAGAAATGAAGGGG 0: 1
1: 1
2: 7
3: 122
4: 1219
1101606170_1101606175 -4 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606175 12:106248486-106248508 CCCTCCCTTCCCGACCTGTGCGG 0: 1
1: 0
2: 1
3: 21
4: 244
1101606170_1101606179 1 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606179 12:106248491-106248513 CCTTCCCGACCTGTGCGGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 74
1101606170_1101606183 14 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606183 12:106248504-106248526 TGCGGAGAGGAGAGAAATGAAGG 0: 1
1: 0
2: 3
3: 53
4: 505
1101606170_1101606187 18 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606187 12:106248508-106248530 GAGAGGAGAGAAATGAAGGGGGG 0: 2
1: 1
2: 20
3: 242
4: 2143
1101606170_1101606188 27 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606188 12:106248517-106248539 GAAATGAAGGGGGGCGCCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 123
1101606170_1101606186 17 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606186 12:106248507-106248529 GGAGAGGAGAGAAATGAAGGGGG 0: 2
1: 1
2: 29
3: 242
4: 1776
1101606170_1101606184 15 Left 1101606170 12:106248467-106248489 CCGCGGGCCAAGCGCGACCCCCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1101606184 12:106248505-106248527 GCGGAGAGGAGAGAAATGAAGGG 0: 1
1: 0
2: 8
3: 102
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101606170 Original CRISPR AGGGGGTCGCGCTTGGCCCG CGG (reversed) Intronic
902520073 1:17011172-17011194 AGGGTGTGGCCCTTGGCCCTGGG + Intronic
903891387 1:26572627-26572649 AGGCGGACGCTCTTGGCCAGGGG + Intronic
905674935 1:39818454-39818476 AGGGGGTGGGGTTTGGCCTGGGG + Intergenic
1063450070 10:6145143-6145165 AGCGCGTCTCGCTTGGCCCCGGG - Intronic
1072013479 10:91323609-91323631 ACGGGGTCGCGGCTGGGCCGAGG + Intergenic
1072050714 10:91700521-91700543 AAGGGGTTGCTCTTGGCCAGAGG - Intergenic
1077264978 11:1644099-1644121 AGGGAGTCTCCCTTGCCCCGGGG + Intergenic
1077520073 11:3027871-3027893 AGGGAGTCTCCCTTGCCCCGCGG + Intronic
1081997323 11:47374103-47374125 AGGAGGTCCCGCTGGGCCCTGGG - Intronic
1088604208 11:111512790-111512812 CGGGGGTCCCGCTGGGCCCGGGG + Intergenic
1089966084 11:122655968-122655990 AGGGAGTCGGGCTGGGCCAGGGG - Exonic
1090699171 11:129279214-129279236 AGGGCGTCGGGCCCGGCCCGCGG - Intronic
1091219344 11:133920857-133920879 AGGGGGCCGGGCCTGGCCTGTGG + Exonic
1091596982 12:1884909-1884931 AGGGGGGTGGGCTTGGCCTGTGG - Intronic
1095752746 12:45729486-45729508 TGGGGGCCGCGCTCGCCCCGCGG + Intergenic
1097127143 12:56783996-56784018 ACGGGGTCGCGGCTGGGCCGAGG + Intronic
1101606170 12:106248467-106248489 AGGGGGTCGCGCTTGGCCCGCGG - Intronic
1103563254 12:121803621-121803643 AGGCGGGCGCGCGGGGCCCGGGG - Intergenic
1114493760 14:23119007-23119029 AGGGGGCCGAGCTGGGCCCGGGG - Exonic
1118890323 14:69903254-69903276 AGGGGGTCGCGGCTGGGCAGAGG - Intronic
1123500747 15:20878551-20878573 AGGGTGTCGCGCTAGTCGCGGGG + Intergenic
1123557993 15:21452244-21452266 AGGGTGTCGCGCTAGTCGCGGGG + Intergenic
1123594221 15:21889525-21889547 AGGGTGTCGCGCTAGTCGCGGGG + Intergenic
1128454123 15:67823229-67823251 CGGGCGCCGCGCGTGGCCCGCGG + Intronic
1129387098 15:75202176-75202198 AGGGAGCCGCGCCTGGGCCGAGG + Intronic
1130126638 15:81099334-81099356 AAGGGGGCGTGCTTAGCCCGAGG + Intronic
1202966344 15_KI270727v1_random:179416-179438 AGGGTGTCGCGCTAGTCGCGGGG + Intergenic
1132885058 16:2178901-2178923 AGGAGGACGCGCAGGGCCCGCGG - Exonic
1142737158 17:1908283-1908305 AGGGGCGCGCGCTAAGCCCGGGG + Intergenic
1142977596 17:3655142-3655164 AGGGGGCCGTGCTGGGCACGTGG + Intronic
1148015377 17:44518238-44518260 AGGGGGTCCTGCCTGGCCAGTGG + Intergenic
1154310630 18:13263787-13263809 AGGGAGTCGAGCTTGGACTGTGG + Intronic
1157810798 18:50694343-50694365 AGGGGGACGTGTTTGGCCCATGG - Intronic
1160659325 19:291043-291065 TGGGGGTCGCGAGAGGCCCGGGG - Exonic
1160768815 19:821457-821479 TGGGGGTCGCGCTGGGGCCCGGG - Intronic
1161029493 19:2051095-2051117 CCGGGGTCGGGCTTGGGCCGGGG + Exonic
1161266560 19:3367085-3367107 AGGGGGTCGTGATTGGACCCTGG + Intronic
1162113328 19:8413256-8413278 AGGCGGTCGCTATTGGTCCGCGG + Intronic
1163158816 19:15452972-15452994 AGAGGGTCGGGCTAGGCCTGGGG + Intronic
1163282766 19:16327073-16327095 AGGGGGCCGCGCCCGGCGCGTGG - Exonic
1164168154 19:22700648-22700670 ACGGGGTCGCGGCTGGGCCGAGG + Intergenic
1166437131 19:42777065-42777087 AGGGAGTCGCCCTTTCCCCGGGG - Intronic
1166851208 19:45762190-45762212 AGGGGGTCGTCTTTGGCCCTGGG + Intronic
1168288458 19:55345891-55345913 AGGAGGTGGGGCTTGGCACGGGG + Intronic
925817422 2:7767364-7767386 AGGGACTCGCGCTGGGCACGGGG + Intergenic
927844294 2:26463452-26463474 AGGGAGTAGCGCTGGGCCCCAGG + Intronic
932699984 2:73985431-73985453 AGGGGGGCGCGCTCGAGCCGCGG - Intergenic
934589317 2:95531893-95531915 ATGGGGTCTCCCATGGCCCGAGG + Intergenic
936389069 2:112055449-112055471 AGGGGCTCGCGCTTGGGCCTGGG - Exonic
937268660 2:120633268-120633290 AGGGGGTAGGACTTGGCCCCTGG + Intergenic
944722371 2:202437029-202437051 ATGGAGTCTCGCTTGGTCCGAGG + Intronic
947729502 2:232420161-232420183 AGGGGGAGGCGCTGGGCACGGGG + Intergenic
949035251 2:241813217-241813239 AGTGGGTCCCGCCTGACCCGTGG + Intronic
1173462274 20:43252871-43252893 AGGGGCTCAGGCATGGCCCGGGG - Intergenic
1174950738 20:55038785-55038807 AGGGGGTCCCTCTTTGCCCAAGG - Intergenic
1175872497 20:62215127-62215149 AGGGGGCCCGGCTGGGCCCGAGG - Exonic
1185098645 22:48825771-48825793 GGGAGGTCACGCTTGGCCCCAGG + Intronic
953149402 3:40310184-40310206 AGGGGGTGGCGCAGGGCCCGCGG - Intronic
971230904 4:24799786-24799808 AAGGCGTCGAGCTTGGCGCGGGG - Exonic
981920273 4:150078654-150078676 CGAGGCTCGCGCTGGGCCCGCGG - Intronic
989178825 5:38556528-38556550 AGCGGGCCGCCCTTCGCCCGTGG - Intronic
999228712 5:150048811-150048833 AGGGGGTAGCACCTGACCCGTGG - Intronic
999300375 5:150486590-150486612 AGGGGGCCGCGCGGGGCCGGGGG + Intronic
1005922138 6:30411680-30411702 AGGGAGTCTCCCTTTGCCCGGGG + Intergenic
1008624789 6:53305560-53305582 ACGGGGTCGCGGCTGGGCCGAGG + Intronic
1033159067 7:138981192-138981214 CCGGGGTCGCGCTGGCCCCGGGG - Exonic
1034268018 7:149790534-149790556 GGGGGGCCGCGCATGGCCGGGGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1060106680 9:120877152-120877174 AGGCGGCTGCGCTCGGCCCGCGG + Exonic
1203760852 EBV:12552-12574 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203761781 EBV:15624-15646 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203762710 EBV:18696-18718 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203763639 EBV:21768-21790 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203764568 EBV:24840-24862 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203765497 EBV:27912-27934 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203766426 EBV:30984-31006 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203767355 EBV:34056-34078 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG + Intronic
1198099867 X:133414599-133414621 AGGGGGGAGCGCTGCGCCCGCGG + Intronic