ID: 1101612591

View in Genome Browser
Species Human (GRCh38)
Location 12:106304585-106304607
Sequence AGTAAAGGGAAGGGAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 546}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101612591_1101612598 29 Left 1101612591 12:106304585-106304607 CCTCTGACTCCCTTCCCTTTACT 0: 1
1: 1
2: 3
3: 43
4: 546
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612591_1101612596 -8 Left 1101612591 12:106304585-106304607 CCTCTGACTCCCTTCCCTTTACT 0: 1
1: 1
2: 3
3: 43
4: 546
Right 1101612596 12:106304600-106304622 CCTTTACTACACATATGTGAAGG 0: 1
1: 0
2: 0
3: 19
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101612591 Original CRISPR AGTAAAGGGAAGGGAGTCAG AGG (reversed) Intronic