ID: 1101612592

View in Genome Browser
Species Human (GRCh38)
Location 12:106304594-106304616
Sequence CATATGTGTAGTAAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101612592_1101612598 20 Left 1101612592 12:106304594-106304616 CCCTTCCCTTTACTACACATATG 0: 1
1: 0
2: 1
3: 14
4: 223
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612592_1101612600 24 Left 1101612592 12:106304594-106304616 CCCTTCCCTTTACTACACATATG 0: 1
1: 0
2: 1
3: 14
4: 223
Right 1101612600 12:106304641-106304663 CTCGATCTAGTGTTGAAGGATGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101612592 Original CRISPR CATATGTGTAGTAAAGGGAA GGG (reversed) Intronic