ID: 1101612593

View in Genome Browser
Species Human (GRCh38)
Location 12:106304595-106304617
Sequence ACATATGTGTAGTAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101612593_1101612600 23 Left 1101612593 12:106304595-106304617 CCTTCCCTTTACTACACATATGT 0: 1
1: 0
2: 3
3: 9
4: 195
Right 1101612600 12:106304641-106304663 CTCGATCTAGTGTTGAAGGATGG 0: 1
1: 0
2: 1
3: 2
4: 48
1101612593_1101612598 19 Left 1101612593 12:106304595-106304617 CCTTCCCTTTACTACACATATGT 0: 1
1: 0
2: 3
3: 9
4: 195
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101612593 Original CRISPR ACATATGTGTAGTAAAGGGA AGG (reversed) Intronic