ID: 1101612595 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:106304600-106304622 |
| Sequence | CCTTCACATATGTGTAGTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 204 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 32, 4: 170} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1101612595_1101612600 | 18 | Left | 1101612595 | 12:106304600-106304622 | CCTTTACTACACATATGTGAAGG | 0: 1 1: 0 2: 1 3: 32 4: 170 |
||
| Right | 1101612600 | 12:106304641-106304663 | CTCGATCTAGTGTTGAAGGATGG | 0: 1 1: 0 2: 1 3: 2 4: 48 |
||||
| 1101612595_1101612598 | 14 | Left | 1101612595 | 12:106304600-106304622 | CCTTTACTACACATATGTGAAGG | 0: 1 1: 0 2: 1 3: 32 4: 170 |
||
| Right | 1101612598 | 12:106304637-106304659 | TGACCTCGATCTAGTGTTGAAGG | 0: 1 1: 0 2: 0 3: 1 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1101612595 | Original CRISPR | CCTTCACATATGTGTAGTAA AGG (reversed) | Intronic | ||