ID: 1101612595

View in Genome Browser
Species Human (GRCh38)
Location 12:106304600-106304622
Sequence CCTTCACATATGTGTAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101612595_1101612600 18 Left 1101612595 12:106304600-106304622 CCTTTACTACACATATGTGAAGG 0: 1
1: 0
2: 1
3: 32
4: 170
Right 1101612600 12:106304641-106304663 CTCGATCTAGTGTTGAAGGATGG 0: 1
1: 0
2: 1
3: 2
4: 48
1101612595_1101612598 14 Left 1101612595 12:106304600-106304622 CCTTTACTACACATATGTGAAGG 0: 1
1: 0
2: 1
3: 32
4: 170
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101612595 Original CRISPR CCTTCACATATGTGTAGTAA AGG (reversed) Intronic