ID: 1101612598

View in Genome Browser
Species Human (GRCh38)
Location 12:106304637-106304659
Sequence TGACCTCGATCTAGTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101612592_1101612598 20 Left 1101612592 12:106304594-106304616 CCCTTCCCTTTACTACACATATG 0: 1
1: 0
2: 1
3: 14
4: 223
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612594_1101612598 15 Left 1101612594 12:106304599-106304621 CCCTTTACTACACATATGTGAAG 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612595_1101612598 14 Left 1101612595 12:106304600-106304622 CCTTTACTACACATATGTGAAGG 0: 1
1: 0
2: 1
3: 32
4: 170
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612593_1101612598 19 Left 1101612593 12:106304595-106304617 CCTTCCCTTTACTACACATATGT 0: 1
1: 0
2: 3
3: 9
4: 195
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612591_1101612598 29 Left 1101612591 12:106304585-106304607 CCTCTGACTCCCTTCCCTTTACT 0: 1
1: 1
2: 3
3: 43
4: 546
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101612598 Original CRISPR TGACCTCGATCTAGTGTTGA AGG Intronic
902355538 1:15896515-15896537 TTAACTAGATTTAGTGTTGATGG - Intronic
915884089 1:159704477-159704499 TGACCTCATTCTAATGATGAGGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
1068516102 10:58027353-58027375 TGCCCTAGACCTAATGTTGATGG + Intergenic
1072048192 10:91678199-91678221 AGAGCACGATCTAATGTTGAGGG + Intergenic
1077302916 11:1855417-1855439 TGCCCTGGACCTAGTGTTGAGGG - Intronic
1097913069 12:64991356-64991378 TGAACTTGTTCTAGTTTTGAGGG + Intergenic
1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG + Intronic
1108994417 13:56709470-56709492 AGACCTTTATATAGTGTTGATGG + Intergenic
1111820338 13:93206432-93206454 TGAACTCTATATAGTGGTGATGG - Intergenic
1113923355 13:113927058-113927080 TGACCTCACTCCAGAGTTGAAGG - Intergenic
1118705611 14:68477673-68477695 TGACCTTTGTCTAGAGTTGATGG + Intronic
1119941116 14:78642675-78642697 TGACCCTGATCTAGAGTAGAAGG - Intronic
1124876822 15:33602692-33602714 AGAACTTGATCAAGTGTTGAGGG + Intronic
1128707130 15:69844488-69844510 TGACTTCACTCTAGTGTAGAGGG + Intergenic
1147910267 17:43851986-43852008 TGACCTTGAGCTTGTGCTGAAGG + Intronic
1148807592 17:50272117-50272139 TGACCCAGATCTAGGGTTGCCGG - Intronic
1155680620 18:28481798-28481820 TTACCCTGATCCAGTGTTGATGG + Intergenic
1159256304 18:65951848-65951870 TGACCTGGACCTAGTGAAGAGGG + Intergenic
933797449 2:85930910-85930932 TGATTTCCATCTAGTGTTGTTGG - Intergenic
940213660 2:151282272-151282294 TGACTTCGGTCTAGTGTAAAAGG - Intronic
940409938 2:153349825-153349847 TCACCTCCCTCTAGTGCTGAAGG - Intergenic
944783090 2:203040091-203040113 TGCCATCTTTCTAGTGTTGAAGG - Intronic
945543350 2:211117568-211117590 AGAGATCGATCTAGTGTTGTTGG - Intergenic
1180927799 22:19568154-19568176 TGACCTGGACCTAGGGGTGAGGG + Intergenic
953473500 3:43186118-43186140 TGAACTCAATTTAGTGCTGAAGG - Intergenic
954868623 3:53750284-53750306 TGCCCTCGATTTAGAGATGAGGG - Intronic
958557814 3:95703098-95703120 TGACCTTAATCTCATGTTGAAGG + Intergenic
959410788 3:106018437-106018459 TGACCTAAGTTTAGTGTTGATGG + Intergenic
960631568 3:119737182-119737204 TGACCTAGATCTGGTAATGAAGG + Intronic
962009242 3:131378108-131378130 TGACCTTGATCACGTGTTCAAGG + Intergenic
963093186 3:141506249-141506271 TGATCTTGATTTATTGTTGAAGG + Intronic
963640146 3:147850913-147850935 TGACTTTGATTTAGTGCTGAAGG + Intergenic
969419488 4:7083648-7083670 TGACCCCGATCTAGAGTGTATGG - Intergenic
980546875 4:134275670-134275692 TAACCTCGATTTAATTTTGAAGG + Intergenic
981744590 4:148040217-148040239 TGGCCTCCATCTAGGGTGGAGGG + Intronic
982094171 4:151905913-151905935 TGTCCTGGTTCTAGTGATGAGGG + Intergenic
997595331 5:135103452-135103474 TGACCTCGAGGTCGTGTTGGGGG + Intronic
998795634 5:145815492-145815514 TGTCCTGGAATTAGTGTTGATGG - Intronic
1007325556 6:41056873-41056895 TTACCTAAATCTAGTGTTGCTGG - Intronic
1009829439 6:68911925-68911947 TGAGGTCAATCTAGTGTTTAAGG + Intronic
1024534386 7:50418200-50418222 TGCCCTCCACCTAGTGGTGAAGG + Intergenic
1031542189 7:123007869-123007891 TGATCTAGATCTAGTGTGGGGGG + Intergenic
1045490049 8:102661297-102661319 TGACACCGTTCCAGTGTTGAAGG + Intergenic
1056198550 9:84252125-84252147 GGACCTCGATCTAGGGGTGGTGG + Intergenic
1195218748 X:102725910-102725932 TAACATAGAACTAGTGTTGAGGG + Intronic
1198045428 X:132897102-132897124 AGTCCACCATCTAGTGTTGAAGG + Intronic