ID: 1101612598

View in Genome Browser
Species Human (GRCh38)
Location 12:106304637-106304659
Sequence TGACCTCGATCTAGTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101612593_1101612598 19 Left 1101612593 12:106304595-106304617 CCTTCCCTTTACTACACATATGT 0: 1
1: 0
2: 3
3: 9
4: 195
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612595_1101612598 14 Left 1101612595 12:106304600-106304622 CCTTTACTACACATATGTGAAGG 0: 1
1: 0
2: 1
3: 32
4: 170
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612591_1101612598 29 Left 1101612591 12:106304585-106304607 CCTCTGACTCCCTTCCCTTTACT 0: 1
1: 1
2: 3
3: 43
4: 546
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612592_1101612598 20 Left 1101612592 12:106304594-106304616 CCCTTCCCTTTACTACACATATG 0: 1
1: 0
2: 1
3: 14
4: 223
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45
1101612594_1101612598 15 Left 1101612594 12:106304599-106304621 CCCTTTACTACACATATGTGAAG 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101612598 Original CRISPR TGACCTCGATCTAGTGTTGA AGG Intronic