ID: 1101614614

View in Genome Browser
Species Human (GRCh38)
Location 12:106324367-106324389
Sequence CATTGTGACGGGAGTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101614614 Original CRISPR CATTGTGACGGGAGTAGAGT TGG Intronic
906747544 1:48232254-48232276 GATTGTGACTGGACTGGAGTAGG + Intronic
909754860 1:79212554-79212576 AATGGTGAAGGAAGTAGAGTAGG - Intergenic
913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG + Intronic
914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG + Intergenic
914150609 1:145038802-145038824 CATTGTAAAGGGAGTAGGGAAGG - Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915578464 1:156797517-156797539 CATTGAGACTGAAGTAGAGCAGG - Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
917021402 1:170592298-170592320 CATTGTGACTGAACTAGAGAGGG + Intergenic
920474314 1:206260006-206260028 CATTGTAAAGGGAGTAGGGAAGG + Intronic
922256677 1:223898500-223898522 CATTGGGTGGGGGGTAGAGTGGG + Intergenic
922855163 1:228768954-228768976 CTTTATGAGGGGAGTACAGTAGG - Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG + Intronic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1067010852 10:42712278-42712300 CATTGTGAGGAGTGTAGAATTGG + Intergenic
1068377139 10:56195519-56195541 CATTGAAGCGTGAGTAGAGTGGG - Intergenic
1068799009 10:61118274-61118296 GATTGTGAATGGAGTAGAGGTGG - Intergenic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074118697 10:110477179-110477201 CATGGTGAAGAGATTAGAGTTGG - Intergenic
1075680160 10:124325768-124325790 CAGAGTGACGGGAGCAGTGTGGG - Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1083244958 11:61419735-61419757 CATTGTGCTGGGAGTCAAGTAGG - Intronic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104986474 12:132600432-132600454 CAGCGTGACGGGACTGGAGTGGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1110619555 13:77579731-77579753 CGTTGTATCTGGAGTAGAGTAGG + Intronic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1119105595 14:71920382-71920404 CATTGTGAGGGGAGTCAAGATGG + Intergenic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1122085303 14:99296788-99296810 CATTGTGACGCGCTTCGAGTGGG - Intergenic
1125121388 15:36162660-36162682 AATTGTGAAGTTAGTAGAGTTGG + Intergenic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG + Intergenic
1135515797 16:23132446-23132468 CATTGTGACGAGTGTATAGATGG + Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1138549562 16:57740153-57740175 CATCGAGACGGGACTAAAGTGGG + Intronic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG + Intronic
1152007564 17:77691995-77692017 CACTGTGACGGGGGTAGGGACGG - Intergenic
1152264676 17:79287412-79287434 CATTGAGTGGGGGGTAGAGTGGG + Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
930126084 2:47797981-47798003 CATTATGAAGGAAGCAGAGTGGG - Intronic
932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG + Intergenic
935167311 2:100580726-100580748 CATTGCCACTGGAGTAGAGGGGG - Intergenic
942454419 2:176128549-176128571 CATTGAAACGGGAGCAGAGAGGG + Intergenic
943101845 2:183496443-183496465 CATCATGCCGGGAGTTGAGTTGG - Intergenic
944120744 2:196238019-196238041 CATTTTGAGGGGATTAGAATTGG + Intronic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
949410185 3:3755045-3755067 CATTTTGCCTGGACTAGAGTTGG + Intronic
949859128 3:8489643-8489665 CATTGTGACAGGAAAAGAATGGG - Intergenic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
956594333 3:70949500-70949522 CATGGAGTGGGGAGTAGAGTGGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958730362 3:97954409-97954431 GATGGTCACGTGAGTAGAGTGGG + Exonic
959228324 3:103615331-103615353 CATTGTGAGGGAAGCAGAGAGGG - Intergenic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
961502008 3:127342871-127342893 CAATGTGAAGGGGGAAGAGTAGG + Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
964175251 3:153820203-153820225 GTTTGTGATGGGAGTGGAGTGGG - Intergenic
965449978 3:168825754-168825776 CATTGTCAATGGAGTAGAGAAGG - Intergenic
966762015 3:183427586-183427608 GCTTCTGACGGGAGTAGGGTGGG - Intronic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
975124059 4:70761944-70761966 CAGTGTGAAGGTAGTACAGTAGG + Intronic
978723447 4:111942171-111942193 CCTTGTGAATGGATTAGAGTGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
982452320 4:155568122-155568144 CTCTGTGAAGGGAGTTGAGTAGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
986961054 5:13213350-13213372 AATTTTGACGGGAGCAGAGCAGG - Intergenic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
988008647 5:25453588-25453610 CTTGGAGAAGGGAGTAGAGTGGG + Intergenic
989562932 5:42872008-42872030 TATTGTGATGGGAGTAGATGCGG - Intronic
991313226 5:65269487-65269509 CATTGTCACGGGAATCAAGTGGG - Intronic
991772589 5:70053586-70053608 AATTATGACAGGAGTAGTGTTGG + Intronic
991851882 5:70929010-70929032 AATTATGACAGGAGTAGTGTTGG + Intronic
993536171 5:89088812-89088834 CATTTTGAGGGGAGTGGAGTAGG + Intergenic
997741786 5:136261425-136261447 CATTGTAACGGGAGAAAAGGTGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG + Exonic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1009814246 6:68710578-68710600 CATTGTGTCAGGAGGAGAGAAGG - Intronic
1013113191 6:107080438-107080460 TATGGTGACTGGAGTAGGGTGGG - Intronic
1013176589 6:107683025-107683047 CATCTTGATGGGAGTAGAGTAGG - Intergenic
1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1028240786 7:88418189-88418211 CACTGAGGCGGGAGAAGAGTAGG - Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG + Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042503095 8:69530932-69530954 CATTCTGTCTGGAGTACAGTAGG - Intronic
1046173573 8:110545643-110545665 CCATGTGACTGCAGTAGAGTTGG - Intergenic
1047756451 8:127922671-127922693 CACTGTGTTGGCAGTAGAGTGGG - Intergenic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1050221637 9:3397603-3397625 CAAGGTGACAGGAGTAGACTTGG + Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051362226 9:16291372-16291394 CATGGTGACTGTAGTACAGTGGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061408061 9:130403497-130403519 CATGGTGACAGGAGAAGGGTTGG - Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1192226343 X:69230800-69230822 CAGTGTGAAGGCAGTAGAGTGGG - Intergenic
1194442233 X:93946780-93946802 CATTCTGACTGGAGTTGAGATGG - Intergenic
1195404020 X:104492980-104493002 CATTGTGGGGGCAGTAGGGTAGG + Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic