ID: 1101614867

View in Genome Browser
Species Human (GRCh38)
Location 12:106326351-106326373
Sequence CTGTCAACAGGGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 325}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101614867_1101614873 -8 Left 1101614867 12:106326351-106326373 CCATCCACCCTCCCTGTTGACAG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1101614873 12:106326366-106326388 GTTGACAGCAACTCAGAGACTGG 0: 1
1: 0
2: 3
3: 17
4: 158
1101614867_1101614878 29 Left 1101614867 12:106326351-106326373 CCATCCACCCTCCCTGTTGACAG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1101614878 12:106326403-106326425 GCAGACTAGGATTCATGAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1101614867_1101614875 7 Left 1101614867 12:106326351-106326373 CCATCCACCCTCCCTGTTGACAG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1101614875 12:106326381-106326403 GAGACTGGTGAAATTCTGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 156
1101614867_1101614876 16 Left 1101614867 12:106326351-106326373 CCATCCACCCTCCCTGTTGACAG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1101614876 12:106326390-106326412 GAAATTCTGTAGGGCAGACTAGG 0: 1
1: 0
2: 2
3: 15
4: 158
1101614867_1101614877 28 Left 1101614867 12:106326351-106326373 CCATCCACCCTCCCTGTTGACAG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1101614877 12:106326402-106326424 GGCAGACTAGGATTCATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 65
1101614867_1101614874 6 Left 1101614867 12:106326351-106326373 CCATCCACCCTCCCTGTTGACAG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1101614874 12:106326380-106326402 AGAGACTGGTGAAATTCTGTAGG 0: 1
1: 0
2: 0
3: 23
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101614867 Original CRISPR CTGTCAACAGGGAGGGTGGA TGG (reversed) Intronic
900397189 1:2457936-2457958 CTGTCCACCGGGCGGGTGGTAGG + Intronic
900618459 1:3576181-3576203 CTGTCTGCCCGGAGGGTGGAGGG - Intronic
900710423 1:4109792-4109814 CTGTCACCAGGGCGAGCGGATGG - Intergenic
900781747 1:4623200-4623222 CTCGGAACAGGGCGGGTGGAAGG - Intergenic
900932791 1:5747507-5747529 CTGACAGCAGGAAGGGAGGAAGG + Intergenic
901479413 1:9514486-9514508 TTGTCCACTGAGAGGGTGGAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902606295 1:17571178-17571200 CTGCCAACCTGGAGGGAGGAAGG + Intronic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903950086 1:26991587-26991609 CAGTGAAGAGGAAGGGTGGAGGG - Intergenic
905725216 1:40245596-40245618 TTTTAAACAGGGGGGGTGGAGGG + Intergenic
906157189 1:43620615-43620637 CTGTCCACACGCTGGGTGGATGG + Intronic
906190236 1:43894237-43894259 CAGTGAACAGGCTGGGTGGAGGG + Intronic
906638238 1:47424756-47424778 CTGTCAAGAGGAAGTGGGGAGGG - Intergenic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907660677 1:56390000-56390022 GAGAAAACAGGGAGGGTGGAGGG + Intergenic
908089176 1:60668755-60668777 CTGTCCACTGGGAGGGAGGGAGG - Intergenic
908333940 1:63100559-63100581 CTGTCGACAGGGTGGCTGAATGG - Intergenic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
911320792 1:96411194-96411216 CTGTCAATAGGGAGGGCAGTTGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
913572196 1:120131808-120131830 GGGGCAACAGGGAGAGTGGATGG + Intergenic
914044889 1:144083105-144083127 CTTACAATAGGGAGGGAGGAAGG - Intergenic
914133221 1:144877581-144877603 CTTACAATAGGGAGGGAGGAAGG + Intergenic
914293116 1:146293452-146293474 GGGGCAACAGGGAGAGTGGATGG + Intergenic
914554160 1:148744235-148744257 GGGGCAACAGGGAGAGTGGATGG + Intergenic
914803005 1:150974305-150974327 CGGGCAACAGGTAGGGCGGAAGG - Intronic
915002465 1:152605960-152605982 CTGTCACCTGGGATGGTTGATGG - Intergenic
915100055 1:153492761-153492783 GTGGCAACAGAGAGGGTGGCTGG - Intergenic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918239854 1:182611653-182611675 ATGTCAACAGGGAGAGTAGGGGG + Intergenic
919510045 1:198450908-198450930 CTGCCAACAGGGAGGGGGTAAGG - Intergenic
920762043 1:208793790-208793812 TTGTCTGCAGGGAGTGTGGAAGG - Intergenic
922318740 1:224465686-224465708 ATGTCAACATTGAGGGAGGAGGG - Intronic
922700596 1:227757748-227757770 CTGTCTACAGTCAGGATGGAAGG + Intronic
924124877 1:240840011-240840033 GTGGTAACAGTGAGGGTGGAGGG - Intronic
1064423468 10:15210100-15210122 CTCTCCCCACGGAGGGTGGAAGG - Intergenic
1065324748 10:24540800-24540822 CTGTCGCCCGGGAGGCTGGAGGG + Intronic
1066957015 10:42182787-42182809 CTTACAATAGGGAGGGAGGAAGG - Intergenic
1069570683 10:69492778-69492800 CTGCCAACAGGGTGGGATGAAGG - Intronic
1069707151 10:70466023-70466045 CTGTCACCGGGGAGGCTGGAGGG + Intergenic
1072323428 10:94273049-94273071 CTGTCAAGGAGGTGGGTGGAGGG - Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1074883650 10:117678005-117678027 CAGTCAAGGGTGAGGGTGGAAGG + Intergenic
1075779221 10:125006133-125006155 CGGCCATCAGGGAGGGTAGAGGG - Intronic
1076030338 10:127152471-127152493 CTGGCAGCAGGAAGGGAGGAGGG - Intronic
1076393654 10:130122266-130122288 CTGTCCACAGGGAGAGGAGAGGG - Intergenic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076729040 10:132429283-132429305 CAGACATCAGGGAGGGAGGATGG - Intergenic
1076863522 10:133155272-133155294 CTGGCAAAACGGAGGGTGAAGGG + Intergenic
1077330030 11:1980142-1980164 CTGTCACCAGGCAAGGTGGGGGG - Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1077964307 11:7111498-7111520 CTGTGAAGAGGGAGGGTCGTAGG - Intergenic
1078891694 11:15563459-15563481 ATGGCAACAGGGAGGGTAGGGGG + Intergenic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080875964 11:36274520-36274542 CTGACAACAGGCAGGATGGTGGG - Exonic
1081747038 11:45480690-45480712 CTGTCCCCAGGGAAGGTGGTGGG + Intergenic
1082997662 11:59266362-59266384 CTGTCCAAATGGAGGGTGGCAGG - Intergenic
1083015120 11:59445157-59445179 CTGTCAGGAGGCAGGGAGGAGGG - Intergenic
1083306809 11:61765770-61765792 CTGTCACCAGGGAGGTCTGAGGG + Intronic
1083365537 11:62139659-62139681 GGGTCAACATGGAGGGTGTAGGG - Intronic
1083789916 11:64977812-64977834 CTGTGCTCAGGGAGGGTTGAAGG - Intergenic
1083961532 11:66017405-66017427 CTGACAAATGGGTGGGTGGAGGG - Intronic
1085052641 11:73387700-73387722 CTGCCAAGAGGGAGGGCGGGTGG + Intronic
1085120141 11:73962307-73962329 CTGACAAGAGTGAGTGTGGATGG + Intronic
1085278087 11:75312693-75312715 CTGACAAGAGGGAGGCAGGAGGG + Intronic
1085311576 11:75520089-75520111 CTGTTCACAGGGAAGGTGGTGGG + Intronic
1085512636 11:77096044-77096066 CAGTCAACAGGGACGAGGGACGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085790404 11:79492851-79492873 CCGTCAACAGAGAGGCTGGTGGG + Intergenic
1085854564 11:80161634-80161656 CTCACCACAGGGAGGGAGGAGGG - Intergenic
1088009392 11:104981017-104981039 ATGCCAACAGGGAGGCTGGGGGG - Intergenic
1089607584 11:119650564-119650586 CTGGCATCAGGGAAGGAGGAAGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090300449 11:125632800-125632822 CCCTCATCAGGTAGGGTGGAGGG - Intronic
1090375654 11:126286984-126287006 CTTTCAAGAGGGAGGCAGGAAGG - Intronic
1090441635 11:126729559-126729581 CTGTAAACAATGAGGCTGGAAGG + Intronic
1202813007 11_KI270721v1_random:35321-35343 CTGTCACCAGGCAAGGTGGGGGG - Intergenic
1092720119 12:11433022-11433044 GTGTAAGCAGGGAGGGTAGAAGG + Intronic
1093182651 12:15984336-15984358 CTGTGGACAGGATGGGTGGAGGG - Intronic
1093247045 12:16752017-16752039 CTGTCAAGAGGGAAGAGGGATGG + Intergenic
1093457866 12:19382370-19382392 CTGGCAACAGAGTTGGTGGAGGG - Intergenic
1094257552 12:28450091-28450113 CTGTCAACAAGGAGAGTAGCTGG - Intronic
1095921092 12:47532317-47532339 CTGTGAACCAGGTGGGTGGATGG + Intergenic
1096009247 12:48198866-48198888 TTGTCAACATGGATGGCGGAAGG - Intergenic
1096578930 12:52572005-52572027 CTGCCAGCAGGGAGAGTAGATGG + Intronic
1096874071 12:54613730-54613752 CTGTCCACAGAGTGGCTGGAGGG + Intergenic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1097066152 12:56322316-56322338 GATTCAACAGGGAGGGAGGAAGG - Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1099585553 12:84508424-84508446 CTCCCAACAGGGAGTGTGCAAGG - Intergenic
1100310556 12:93391093-93391115 CTGGCAGCAGGGAGGGAGCAGGG + Intronic
1100539873 12:95548265-95548287 CGGTAATCCGGGAGGGTGGAGGG + Intronic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1103037396 12:117667494-117667516 GTGTGAACAGGAGGGGTGGAAGG + Exonic
1103334258 12:120177416-120177438 CTGTCAACCAGGATGGTGGGAGG - Intronic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1103993007 12:124811823-124811845 CTGTCGCCAGGGAGAGGGGAGGG - Intronic
1107996251 13:45864158-45864180 CTGGCAACAAGGAGGGTGGTGGG + Intergenic
1109707202 13:66111950-66111972 GTGACAACAAGGAGGGTAGATGG - Intergenic
1112496516 13:99910055-99910077 CTGGCAGCAGGGAGCTTGGAAGG - Intergenic
1113270095 13:108663614-108663636 CTGTCAAGAGGGAATGTAGAGGG - Intronic
1113559611 13:111267689-111267711 TTGGCAACAGGGAGGGTGGATGG + Intronic
1113648342 13:112014832-112014854 CTGTCAACACTGAGGGTGCCAGG - Intergenic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1113778673 13:112963357-112963379 CTGGCATCAGAGCGGGTGGAGGG + Intronic
1113894323 13:113754174-113754196 CTCACTACAGGGAGGCTGGAAGG - Intergenic
1116510434 14:45738722-45738744 CTGTCAACAGGATGAATGGATGG - Intergenic
1116595142 14:46832345-46832367 CGGTCAATAGAGATGGTGGAAGG - Intergenic
1119475018 14:74922286-74922308 GAGACAACAGGCAGGGTGGAGGG - Exonic
1121043957 14:90774537-90774559 CTGTTCACAGAGGGGGTGGAGGG - Intronic
1122369484 14:101221461-101221483 CTGTGACCAGGGAGGCTGCAAGG - Intergenic
1122563688 14:102635943-102635965 CTGTCAGAAGGGAGGGAGGGAGG - Intronic
1202936096 14_KI270725v1_random:88989-89011 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1125970445 15:43907086-43907108 CTCTCCACAGGGAGGATGGTGGG + Intronic
1127449524 15:59103270-59103292 CTCAGAAGAGGGAGGGTGGAAGG - Intergenic
1128246655 15:66137461-66137483 GTGCCAACAGTGAGGGAGGAAGG + Intronic
1130997740 15:88913152-88913174 TTGTCAACAGTGGAGGTGGAGGG + Intronic
1132284718 15:100654529-100654551 CTGACAGCAGGGAGGCTGAAGGG - Intergenic
1135358824 16:21793597-21793619 CTGTCATGAGGGAGACTGGAAGG + Intergenic
1135457380 16:22610033-22610055 CTGTCATGAGGGAGACTGGAAGG + Intergenic
1135624590 16:23982752-23982774 CTGTAATAAGGGAGGGTGGGAGG + Intronic
1135757054 16:25107157-25107179 CGGCCAAGAGGGCGGGTGGACGG - Intergenic
1136634849 16:31514089-31514111 CTGTCACCAGGCTGGGTGCAGGG + Intergenic
1137019241 16:35407167-35407189 CTGTTACCATGGAGGCTGGAAGG - Intergenic
1137912364 16:52391134-52391156 GAGTCAACAGGGAGAGTGGGAGG - Intergenic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138409180 16:56824448-56824470 GTGTCCACAGGGAGGGATGATGG - Intronic
1138684375 16:58711845-58711867 CAGGCAACAAGGAGGATGGAGGG - Intronic
1139267862 16:65656665-65656687 CTGTCCACAGGGTGGCTGGGAGG + Intergenic
1139457334 16:67092057-67092079 CTGTCAAGGGGTAGGGGGGAAGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1141046111 16:80717449-80717471 CTGCCACCAGGGAAGGTGGATGG + Intronic
1141432074 16:83975450-83975472 GTGTCCACAGGAAGGATGGATGG + Intronic
1141873741 16:86807166-86807188 CTGTTGACAAGGAGGCTGGAAGG + Intergenic
1141988375 16:87594569-87594591 GTGACAACAGGGAGGCAGGAGGG + Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142132057 16:88435658-88435680 CTGTGTCCAGGGAGGATGGATGG + Exonic
1142311870 16:89318865-89318887 CAGGCATCAGGGATGGTGGATGG - Intronic
1142675645 17:1511679-1511701 GTGCCAACAGGGATGGAGGACGG + Intronic
1143462624 17:7114008-7114030 CTGTGAACAGGGACTGAGGAGGG - Intronic
1143510145 17:7390796-7390818 CTGTCATCAGGGAGGGAGAAAGG + Intronic
1143623793 17:8096530-8096552 CTGAGAACAGGGAGGATGGAAGG + Exonic
1145369126 17:22294248-22294270 CTGGCTACAGGGTGGGTGGGAGG - Intergenic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1146321950 17:31853817-31853839 CTGACATCAGGGAGGCCGGAAGG + Intronic
1146353981 17:32118873-32118895 CTGTCACTAGGGAGTGAGGAGGG - Intergenic
1146385688 17:32370611-32370633 CTGACACCATAGAGGGTGGAAGG - Exonic
1146795728 17:35779231-35779253 ATGCCATCAGGTAGGGTGGAGGG - Exonic
1146839081 17:36137082-36137104 CTGACAACAGGGTGGGTGGTTGG + Intergenic
1146940654 17:36842299-36842321 CTGTCTTCAGGGAGTCTGGATGG + Intergenic
1147630103 17:41924713-41924735 CTGCCACCAGGGAAGCTGGAGGG + Intronic
1148135446 17:45288932-45288954 CCATCAACAGGGAGGGTGCTGGG - Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148971818 17:51490452-51490474 CTGTCATCAGGGTTGATGGAGGG - Intergenic
1149501331 17:57154836-57154858 CTGTCAATAGGGAGTATAGAAGG + Intergenic
1149545967 17:57504223-57504245 CTAGCAACAAGGAGGCTGGATGG - Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1149784216 17:59421796-59421818 CTGTTAACAGGGAGGATAAATGG + Intergenic
1150209979 17:63436521-63436543 CTGACAAGAAGGTGGGTGGAGGG - Intronic
1150960659 17:69908806-69908828 CTGGCAACAGAGAGAGTGGTGGG - Intergenic
1152314555 17:79572545-79572567 CTCTCAACAGGGTGGGGGGAGGG + Intergenic
1152717395 17:81906623-81906645 CTGTCAGCAGGGAGGATGGCGGG - Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156321455 18:36028925-36028947 CTTTCATCAGGGAGAGCGGAAGG + Intronic
1156493927 18:37513330-37513352 CTGTCATCTGGGAGGTGGGATGG + Intronic
1159653021 18:70999940-70999962 GTGTGAACAGGGGGTGTGGATGG + Intergenic
1159760243 18:72416796-72416818 CTGTCATGAGGGTGGGAGGAGGG + Intergenic
1160040481 18:75340394-75340416 ATGTGAACTGGGAGGATGGACGG + Intergenic
1160239311 18:77111735-77111757 CTCTCTGCAGGGAGGGTGGGCGG - Intronic
1160584464 18:79904693-79904715 CTATCACCAGGGAGGGAGGCCGG - Intronic
1160968200 19:1755798-1755820 TTGTCAGCTGGGAGGGAGGAGGG - Intronic
1161089890 19:2354440-2354462 CACTCAACAGGGCGGGTGGCGGG - Intronic
1161442879 19:4302403-4302425 CTGTCAACTGGGAGGGGGAGAGG - Exonic
1162930610 19:13955761-13955783 CTGTCCTCAGGCAAGGTGGAGGG + Intronic
1163472437 19:17505425-17505447 CATTCAGCAGGGAGGGCGGAGGG - Exonic
1166014144 19:39967430-39967452 CTGGAAACAGGGAGGATGGGAGG + Intergenic
1166040626 19:40200357-40200379 CTGTCACCAGTGAGAGTTGATGG + Intronic
1166196248 19:41207638-41207660 ATGTCAACAGCCAGGGTGGGCGG - Intergenic
1166405483 19:42519018-42519040 CTGTCAAGAGGGAGGATGCTGGG - Exonic
1166688590 19:44809994-44810016 CTGTCCCCAGGGAGGGGTGACGG - Intronic
1168322468 19:55518296-55518318 CTGTCCCCAAGGAGGTTGGAAGG - Exonic
1202684447 1_KI270712v1_random:36509-36531 CTTACAATAGGGAGGGAGGAAGG - Intergenic
925284565 2:2707282-2707304 CTGGCAGCAGCGAGGGTGGGTGG - Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927482142 2:23462453-23462475 CTGTCACTAGGGAGTCTGGAGGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930934637 2:56933039-56933061 CTGTAAGCAAGGAGGGTGAAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932800390 2:74737212-74737234 AAGTCAATAGGGAGGGTGGAAGG - Intergenic
934247271 2:90318337-90318359 CTTACAATAGGGAGGGAGGAAGG + Intergenic
934262054 2:91484266-91484288 CTTACAATAGGGAGGGAGGAAGG - Intergenic
934877883 2:97942319-97942341 CTGTCAATGGGGTGGGGGGAGGG + Intronic
934891841 2:98077628-98077650 CTGTCAATGGGGTGGGGGGAGGG + Intergenic
935942834 2:108259270-108259292 CTGCAAACAGGCAGGGTGAAGGG - Intronic
936526140 2:113242731-113242753 CTGTCCATAGGGAGGTTGAATGG + Exonic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
939167795 2:138658204-138658226 AGCTCAAGAGGGAGGGTGGAAGG - Intergenic
939258878 2:139781274-139781296 CTATCAAAAGGAAGGGAGGAAGG - Intergenic
939968706 2:148636859-148636881 GTGTCAACTGGGAGTGGGGAGGG + Intergenic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
942114104 2:172711337-172711359 ATGTAAACTGTGAGGGTGGAAGG - Intergenic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
945436870 2:209829109-209829131 CTGTCACCAGCGAGTGGGGATGG + Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948663579 2:239521173-239521195 CTGTCCACAGGGACCCTGGAGGG + Intergenic
948706986 2:239801097-239801119 CTGGCAACAGGGAGGGGGTGTGG - Exonic
1169278843 20:4250343-4250365 CTTTTAACAGGGAGGATGGAAGG + Intergenic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1172801695 20:37580661-37580683 CTGTAAACAGGCTGGGTGCAGGG + Intergenic
1173299503 20:41789215-41789237 CTGTCAACAGGGAAAGTGGGGGG + Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175649048 20:60701132-60701154 CAATAAAAAGGGAGGGTGGATGG - Intergenic
1175817916 20:61893227-61893249 GTGACCACAGGGATGGTGGATGG + Intronic
1176039241 20:63055785-63055807 ATGGCATGAGGGAGGGTGGAGGG - Intergenic
1178583212 21:33853213-33853235 CTGTCTCCAGGCAGGGTGGTAGG + Intronic
1178589167 21:33894865-33894887 CTGTCACCGGCGGGGGTGGAGGG + Exonic
1180091295 21:45534994-45535016 CTCTGAACAGGGAGGCGGGAAGG + Intronic
1180280444 22:10688669-10688691 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1181662859 22:24365975-24365997 TTGTAGACAGGGAGGGTGGGGGG + Intronic
1181766576 22:25096482-25096504 CGGGCAACAGGGAGGGAAGATGG - Intronic
1182027780 22:27134088-27134110 CAGTCACCAGGGAGGGCAGAGGG + Intergenic
1182853037 22:33492872-33492894 ATCTCCACAGGGAGGGAGGAGGG + Intronic
1182956572 22:34432305-34432327 CTGCCAAAAGAGTGGGTGGATGG + Intergenic
1184493456 22:44823852-44823874 CTGGCAACACTGAGGGTGCAGGG + Intronic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950728946 3:14939407-14939429 CTGTGCACAGGCAGGATGGAGGG + Intergenic
952083995 3:29795704-29795726 CTGTAAACTGGGAGGAAGGAGGG + Intronic
952304092 3:32130130-32130152 CTGCGAACAGGGAGAGTGGGAGG + Intronic
952450707 3:33430071-33430093 CTATCCTCAGTGAGGGTGGATGG - Intronic
953210606 3:40871685-40871707 CTTTCATCAGGGAGGATGAAAGG - Intergenic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
956273331 3:67470972-67470994 CTGTTAACTGGGAGGGTGATGGG + Intronic
956365481 3:68497506-68497528 ATGTCAGTTGGGAGGGTGGAAGG + Intronic
956603258 3:71046082-71046104 ATGTCAAGAGGGAGGGAGGGCGG - Intronic
956773216 3:72544450-72544472 CCATCAGCTGGGAGGGTGGAGGG + Intergenic
957639428 3:82832331-82832353 CTGTCAGCAGGGATCGGGGAGGG + Intergenic
958192758 3:90204594-90204616 CTGTGAACTGGGCGGTTGGATGG - Intergenic
959202187 3:103261391-103261413 CTGCCAACAGGCATGGTGGATGG + Intergenic
960959694 3:123061519-123061541 CTCTGAACAGGGAAGGTGAAAGG - Intergenic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962946899 3:140180178-140180200 CTGCCAACTGGCAGGGAGGAGGG - Intronic
963102964 3:141623319-141623341 CCTTCAAGAGGCAGGGTGGAGGG - Intergenic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964462705 3:156953503-156953525 CTGTCAACTGGGGGGTTGAAGGG - Intronic
966881268 3:184352609-184352631 CTGACAGCAGGGAGGGCCGAAGG + Intronic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
969512019 4:7623543-7623565 CGGGCAACAGGGAGTTTGGAAGG - Intronic
969520847 4:7677098-7677120 GTGGCAGCAGGGAGGGTGGAGGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969613792 4:8240939-8240961 CTGTCCTCAGCGAGGGTGGCTGG - Exonic
969684864 4:8665709-8665731 CTGTCCCCAGGGAGGGAGGGAGG + Intergenic
971420347 4:26468568-26468590 CTGTCAATGGGGTGGGTGTAAGG - Intergenic
975197398 4:71541688-71541710 CTGGCAGCAGTGAGGATGGATGG + Intronic
975702937 4:77083891-77083913 CTGGAAACAAGGAGGGTGGGGGG + Intergenic
977570434 4:98623388-98623410 TTGTCAGCAGGGAGGGTGTGTGG - Intronic
978730997 4:112026116-112026138 CTGTCAGCAGGGAGGGGAAAGGG + Intergenic
984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG + Intronic
985065486 4:186116629-186116651 CTGTCACCAGGCTGGCTGGAGGG + Intronic
985697128 5:1346924-1346946 CTCTCAACAGGGCAGGGGGACGG - Intergenic
986295451 5:6433920-6433942 CTGTCAAGAGGGTGGGTGATGGG - Intergenic
986446708 5:7827606-7827628 GTGTCAAAAGGGAGAATGGATGG - Exonic
988971334 5:36471276-36471298 CTGTCAAGGGGTGGGGTGGAAGG + Intergenic
991436988 5:66606742-66606764 CTTGCAACAGGGAGGGTGCATGG + Intronic
993702580 5:91135819-91135841 CTGTGAACAGGGATTGTGCAGGG + Intronic
994533831 5:101001897-101001919 ATGTCAAAAGGCAGGGTTGAAGG + Intergenic
995116113 5:108481617-108481639 CTGTCAACAGGCGGAGGGGACGG + Intergenic
997055457 5:130438313-130438335 CTATGCACAGGAAGGGTGGATGG + Intergenic
998269211 5:140691567-140691589 CAGACACCAGGAAGGGTGGAGGG - Exonic
998911778 5:146967752-146967774 CTGCAAACCGGGAGGGAGGAGGG - Intronic
999154773 5:149450427-149450449 CTGACAGCTGGGAGGGTGGCTGG - Intergenic
1000165361 5:158643023-158643045 CCATCAACAGAGAGGGTGTATGG - Intergenic
1001355918 5:171022625-171022647 CTGGGACCAGGGAGGCTGGAAGG - Intronic
1001667220 5:173443356-173443378 CTGTCACCTGGGAGGGTTGGAGG + Intergenic
1002429330 5:179194029-179194051 CTGTCATCCGGGTGTGTGGATGG + Intronic
1005041329 6:21602926-21602948 CTTTTAACAAGGATGGTGGAAGG - Intergenic
1006026483 6:31150377-31150399 CTGCCCACAGGGAGGGAGGCAGG + Intronic
1006186092 6:32182500-32182522 CTAGCAACAGGGAGGGCAGAGGG - Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006341498 6:33449508-33449530 CTGACATTAGGCAGGGTGGATGG + Intronic
1006682774 6:35809059-35809081 CTGGGAACAGGGAGGGGGCAGGG + Intronic
1006881985 6:37348301-37348323 CTGTCAAGAGGAAGGAGGGACGG + Intergenic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1013619952 6:111878452-111878474 CAGACCACAGGGAGGGTGAATGG + Intergenic
1013796304 6:113893342-113893364 TGGCCAACAGGGAGGGAGGAGGG + Intergenic
1015025939 6:128532550-128532572 CTGACAACAGGGATGTAGGATGG - Intergenic
1015707504 6:136104048-136104070 CTGTCCTCAGGGAGGGTGAGGGG + Intronic
1016995859 6:149962187-149962209 CTGACTTCAGGGAGGGTGGCAGG + Intergenic
1019138808 6:169929969-169929991 GAGTCAACAGTGAGGGTGGGAGG + Intergenic
1021370888 7:19845018-19845040 CTGTCAGCAGGTAGAGGGGAGGG + Intergenic
1022902599 7:34825607-34825629 AGGTCACCAGGGAGGGTGGAAGG + Intronic
1023092404 7:36629402-36629424 CATTCAACAGGGAGGGGGCAGGG + Intronic
1023340000 7:39210008-39210030 CAGTCAACAGCGAGGGGAGAAGG + Intronic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1024565066 7:50673938-50673960 GTGGAAACAGGGAGGCTGGAGGG - Intronic
1026448711 7:70508260-70508282 CTGTCAAAAAGGAGGGGGGTAGG + Intronic
1026984383 7:74545851-74545873 CTGCAAACAGGGCGGCTGGAGGG - Intronic
1027974828 7:85138808-85138830 CTGTCAGCAGGTAGGGGGCAGGG - Intronic
1028329789 7:89576005-89576027 CTGTCATGAGGTAGGGGGGAGGG + Intergenic
1029253290 7:99252057-99252079 TTGGCAACAGTGATGGTGGAGGG + Intergenic
1029518289 7:101042202-101042224 CTGTCAACAGAAGGAGTGGAAGG - Exonic
1030196207 7:106856027-106856049 CTGTCAGCAGGGAGGGAGACTGG - Intergenic
1031759837 7:125698907-125698929 CTTTTAACAGGGAGGCAGGAGGG - Intergenic
1034516568 7:151585522-151585544 CTGAGAACAGGGAGGGAGAATGG - Intronic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035083899 7:156239791-156239813 ATGTCTACAGTGAGGGTGAAGGG + Intergenic
1035224249 7:157424873-157424895 CTTTCATCCTGGAGGGTGGAGGG + Intergenic
1035982178 8:4384890-4384912 CTATCAACAGAGTGGCTGGATGG + Intronic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1040594462 8:48824079-48824101 CTGTCAACAGGGGGAAAGGAAGG + Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1043763722 8:84102473-84102495 CAGCCAACAGTTAGGGTGGAGGG + Intergenic
1044113820 8:88309421-88309443 CTATAAAGAGGGAGGGTGGTAGG + Intronic
1045444645 8:102248092-102248114 TTGTCAAGGTGGAGGGTGGAGGG + Intergenic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1048120771 8:131579090-131579112 CTGTTAAGAAGGAGGATGGAAGG + Intergenic
1048179548 8:132182491-132182513 ATCTCCCCAGGGAGGGTGGAGGG + Intronic
1049004647 8:139847108-139847130 CTGACAACAGGGAAGGAAGAAGG + Intronic
1052642346 9:31184989-31185011 ATGGCAAAAGGGAGGGTGGGAGG + Intergenic
1052741604 9:32398408-32398430 CTGTCAGCTGGGTGGGTGTATGG + Intronic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1056913539 9:90725357-90725379 CTGTCTACAGGAAGGAGGGAAGG - Intergenic
1057292768 9:93818064-93818086 CTGTCAAAAGGAAGGAGGGAGGG + Intergenic
1058666253 9:107318731-107318753 CACTAAAAAGGGAGGGTGGAGGG - Exonic
1058766820 9:108189916-108189938 CTGGCAGCAGGGAGGGGGCAGGG + Intergenic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1060847859 9:126851368-126851390 CTGCCTACAGGCAGGGTGGCTGG + Intergenic
1062494979 9:136827378-136827400 CTGCCAAGAGGGAGGCTGAATGG + Intronic
1187159069 X:16747589-16747611 CTGTCAACAGTGAGAGGGGGCGG - Intronic
1187818703 X:23261878-23261900 CTGTCAGAAGGGAGTGTGGGAGG + Intergenic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1188539436 X:31233099-31233121 CTGTCAAGAGGGAGACTGCAAGG - Intronic
1188939193 X:36216312-36216334 ATGTCAACAGGGATGGTAGGGGG - Intergenic
1189605704 X:42675445-42675467 GTGGCAGCAGGAAGGGTGGAAGG + Intergenic
1192428860 X:71099334-71099356 ATGTCACCAGTGAGGGAGGAAGG + Intronic
1195429729 X:104775240-104775262 CTGTCTACAATCAGGGTGGATGG + Intronic
1195433970 X:104821392-104821414 CTGTCAACAGGTGGGGGGCAAGG - Intronic
1196749747 X:119105148-119105170 CTGTCAAGAGGGAGAATAGAAGG + Intronic
1199771480 X:150977936-150977958 CTGGTAACAGGGAGGGGTGAGGG + Intergenic
1199830038 X:151540152-151540174 CTGTCATCATGGAGAGGGGAAGG + Intergenic