ID: 1101619888

View in Genome Browser
Species Human (GRCh38)
Location 12:106375089-106375111
Sequence CAGAATACACAAATCGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101619886_1101619888 0 Left 1101619886 12:106375066-106375088 CCTCATTCTGAGTGAATACGTAG 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101619888 Original CRISPR CAGAATACACAAATCGAGGT TGG Intronic
905428384 1:37902432-37902454 AAGAAAACACAAATCTGGGTGGG + Intronic
906770871 1:48481669-48481691 CAGAATACTCCAAGCGAGGTTGG + Intergenic
908129448 1:61059982-61060004 CAGAAGAGACAAATGGAAGTAGG + Intronic
910584923 1:88869033-88869055 CAGAATACACAGATACAGGCCGG - Intronic
912970441 1:114276524-114276546 CAGAGTACAGAATTCTAGGTTGG - Intergenic
914789743 1:150867232-150867254 CAGATTACTCAAATAGAGCTGGG + Intronic
916002468 1:160630142-160630164 CAGAATACAGTCATCGAGGATGG + Intronic
918151331 1:181799995-181800017 CAGAACACACATATCCAAGTAGG + Intronic
918415557 1:184302955-184302977 CTGAATAAACAACTCTAGGTTGG + Intergenic
921383270 1:214546228-214546250 CTGAATCCAGAAACCGAGGTAGG + Intronic
924435221 1:244033673-244033695 CATAATAAATAAATCAAGGTTGG - Intergenic
1063856980 10:10265998-10266020 CAGAATATAAAATTCTAGGTAGG + Intergenic
1065087944 10:22199011-22199033 CAGGATACAGGAATCTAGGTTGG + Intergenic
1065603137 10:27390096-27390118 CAGGATACAAAATTCTAGGTTGG + Intergenic
1068441921 10:57067775-57067797 CTGAGTACAGAAATCTAGGTTGG + Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1069808592 10:71141882-71141904 CAGAATCCACAAACCCAGGAGGG + Intergenic
1070745489 10:78931304-78931326 CAAAACACACAAAGGGAGGTGGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1085148160 11:74222782-74222804 CAAAATGCCCAAATCGAGCTGGG - Intronic
1087738263 11:101858789-101858811 CAGAATACACAAATAGGTGGAGG - Intronic
1090841759 11:130495755-130495777 CAGAGTACAGAATTCTAGGTTGG + Intergenic
1092002074 12:5041228-5041250 AAGAAGACAGAGATCGAGGTAGG + Intergenic
1092400402 12:8171553-8171575 CAGAAAACACAAAATGACGTAGG - Intronic
1093122594 12:15290864-15290886 CAAAATACAAAAATGGAGGCTGG + Intronic
1097051424 12:56225345-56225367 CGGAACAGATAAATCGAGGTGGG - Intronic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102995757 12:117349165-117349187 CAGAATAGACAAATCCACGGAGG - Intronic
1105204549 13:18209629-18209651 CAGAATACAGAATTTTAGGTTGG - Intergenic
1106216225 13:27702898-27702920 CTGAATACAGAATTCTAGGTTGG + Intergenic
1106786504 13:33113200-33113222 CAGAATACAGAAAACCAGGATGG - Intronic
1113050537 13:106206451-106206473 CAGAATACAGAACTCAAGCTGGG - Intergenic
1113316879 13:109189898-109189920 AACAAAACACAAATCGTGGTAGG - Intronic
1114819346 14:25997984-25998006 CAGAGTACAGAACTCTAGGTTGG - Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1117077233 14:52116822-52116844 ATGAATCTACAAATCGAGGTAGG - Intergenic
1120988173 14:90352284-90352306 CAAAAAACACAAAACGAGCTGGG + Intergenic
1123692599 15:22851305-22851327 CATAATATACAAATCTAGTTTGG - Intronic
1130249639 15:82290334-82290356 CAGAATATAGAATTCTAGGTTGG - Intergenic
1130450469 15:84046163-84046185 CAGAATATAGAATTCTAGGTTGG + Intergenic
1143122392 17:4616854-4616876 CTGAATAAACAAATCCCGGTAGG - Intergenic
1143390829 17:6558245-6558267 CAGCATACACATAACGAAGTGGG + Intergenic
1150139947 17:62719399-62719421 CAGGGTACAGAAATCTAGGTTGG + Intronic
1156089431 18:33448056-33448078 CAGGATACAGAATTCTAGGTTGG - Intergenic
1157073369 18:44436419-44436441 CAGGATACAGAATTCTAGGTTGG + Intergenic
1157513762 18:48296481-48296503 CAGAAAAGACAAATAGAGATGGG - Intronic
1159282918 18:66310464-66310486 CAGAAATCAAGAATCGAGGTTGG - Intergenic
1159647304 18:70934031-70934053 CAGCATAGACAAAGCGTGGTTGG - Intergenic
925017086 2:537553-537575 GATAATACACTAATCAAGGTTGG + Intergenic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
927242156 2:20928633-20928655 CAGAAGACAAAAATTGAGGTTGG - Intergenic
928673612 2:33627900-33627922 TAGAATACACCAATCTAGGCTGG - Intergenic
939870387 2:147520230-147520252 CAGAATTCAGAAAACAAGGTGGG - Intergenic
939956431 2:148531521-148531543 CAGGACAGACAAATCCAGGTGGG - Intergenic
941013362 2:160326440-160326462 GAGAAAACAAAAATCTAGGTGGG + Intronic
942860696 2:180607652-180607674 CACAATACACAACTGTAGGTTGG + Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
1170022962 20:11856058-11856080 CAGGATACAGAATTCTAGGTTGG - Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173043956 20:39491748-39491770 CAGAATCCTGAAATCAAGGTAGG + Intergenic
1173544042 20:43878792-43878814 CAGGATACACAAATCGGGTGAGG - Intergenic
1174594976 20:51676773-51676795 AAAAATACAAAAATTGAGGTTGG - Intronic
1174618805 20:51858121-51858143 CAGAACACAAAAACCCAGGTTGG + Intergenic
1178042514 21:28655204-28655226 TAGAATAGACAAATAGAGGAGGG - Intergenic
1181778336 22:25175883-25175905 CAGGAGACCCAAATCGTGGTGGG - Intronic
1182700792 22:32236364-32236386 GATAATACACAAATATAGGTTGG - Intronic
1184143501 22:42594262-42594284 TAAAAAAAACAAATCGAGGTGGG + Intronic
1185090519 22:48767267-48767289 AAGAATATACAATTCGAAGTAGG - Intronic
952633423 3:35497788-35497810 CAGAATACAAATTTCTAGGTTGG + Intergenic
958497301 3:94861852-94861874 CAGAATATATAATTCCAGGTTGG + Intergenic
959807724 3:110577391-110577413 CAAAAGTCACAAATCCAGGTAGG + Intergenic
963522787 3:146376854-146376876 GAGAATAGACAAATAAAGGTGGG + Intergenic
965446808 3:168783112-168783134 CAGAGTACAGAATTCTAGGTTGG - Intergenic
968386552 4:144230-144252 CAAAATACACAAAGCAAGGAAGG - Intronic
972413972 4:38820712-38820734 CAGAAGTCAGAAATCAAGGTTGG - Intronic
977388525 4:96377392-96377414 CAGAATACAGAGGCCGAGGTGGG + Intergenic
979621639 4:122804983-122805005 CAGAATACACAGGTCCAGTTAGG + Intergenic
982147187 4:152407727-152407749 CAGAATAAATAAATAGAGGGTGG - Intronic
985937656 5:3109074-3109096 CAGAATGCACACATCGAGGATGG - Intergenic
987337240 5:16907672-16907694 CAGAATACACAACTCACTGTGGG + Intronic
987441515 5:17962556-17962578 CAGAAAACCCAAATTGATGTTGG + Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
990967101 5:61460916-61460938 CAAAATACATAAATATAGGTAGG - Intronic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
995690955 5:114825325-114825347 CAGAAGTCAAAAATGGAGGTTGG - Intergenic
997174146 5:131756613-131756635 CAGAATACACTTAATGAGGTAGG + Intronic
1004712309 6:18183805-18183827 GAGAATACACACACCAAGGTAGG - Intronic
1004741652 6:18467538-18467560 CAGAATCAACAAAACTAGGTTGG + Exonic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1007662663 6:43496267-43496289 CAGAATCCACATACCCAGGTGGG + Intronic
1013146987 6:107403610-107403632 CAGAAAACAAGAATTGAGGTTGG - Intronic
1017085671 6:150710687-150710709 CAGAAAAAAAAAATCTAGGTTGG + Intronic
1019351119 7:554532-554554 CAGAAAACCCAAATTGAGGCTGG + Intronic
1019912147 7:4107096-4107118 CCGAATACACACATCCAGGGTGG + Intronic
1029949281 7:104565991-104566013 CAGAAGAGCCAAATAGAGGTAGG + Intronic
1031873514 7:127112375-127112397 CAGAATACACAAATTAATGCAGG - Intronic
1032511821 7:132478837-132478859 CAGAATACTCATATCTTGGTGGG + Intronic
1033853984 7:145534554-145534576 TAGTATACACAAATAGATGTGGG + Intergenic
1035150514 7:156867700-156867722 CAGAATAGACAAATCTATATAGG + Intronic
1040691112 8:49939768-49939790 CAGAATAGAGAAATTGAGGGTGG - Intronic
1041849860 8:62378686-62378708 CAGAAGACAAGAATTGAGGTTGG + Intronic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1043743243 8:83841128-83841150 CAGAATACAGAAAGCAAGCTTGG - Intergenic
1044460393 8:92437768-92437790 CAGACTACACAAATTGTGGGTGG + Intergenic
1045838549 8:106552386-106552408 CAGAATATTCATATAGAGGTGGG - Intronic
1046502149 8:115092484-115092506 CAGGATACAGAAGTCTAGGTTGG + Intergenic
1046950694 8:120016907-120016929 CAGAATTCATACATTGAGGTTGG - Intronic
1051015848 9:12474956-12474978 CAGAAGTCAAAAATTGAGGTTGG + Intergenic
1051878315 9:21813579-21813601 TCAAATACACAAATCGAGTTGGG - Intronic
1055448895 9:76412528-76412550 CAGGATACACAATTCTAGTTGGG + Intergenic
1056401918 9:86236213-86236235 CAGAATACAGAATTCTAGGTTGG - Intronic
1056725338 9:89109386-89109408 CAGAATACATACATAGAGTTGGG + Intronic
1058366024 9:104209395-104209417 CTGAATACACAAAGAGAAGTAGG - Intergenic
1058938121 9:109788098-109788120 CAGAATACTCACATCTAGATAGG + Intronic
1186829113 X:13372859-13372881 CAGAATGCAAAAATCAAAGTGGG + Intergenic
1190984897 X:55491323-55491345 CTGAATAAACCAATCTAGGTAGG - Intergenic
1193066185 X:77263121-77263143 CTGAATACAGAATTCAAGGTTGG - Intergenic
1194049645 X:89053233-89053255 CAGAAGACACATATTGAGGCTGG - Intergenic
1194736421 X:97517334-97517356 AAAAATACAGAAATCGAGATAGG - Intronic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1199555433 X:149103014-149103036 AAGAATACAAAAATAGAGGTAGG + Intergenic
1201322307 Y:12713568-12713590 CAGAATACAGAATTCTAGATAGG + Intronic