ID: 1101622435

View in Genome Browser
Species Human (GRCh38)
Location 12:106401959-106401981
Sequence CAGGGCAATCAGGCAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8822
Summary {0: 1, 1: 11, 2: 2856, 3: 4583, 4: 1371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101622427_1101622435 12 Left 1101622427 12:106401924-106401946 CCACTCCTATTCAACATAGTGTT 0: 8383
1: 5167
2: 3784
3: 3774
4: 4310
Right 1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG 0: 1
1: 11
2: 2856
3: 4583
4: 1371
1101622429_1101622435 7 Left 1101622429 12:106401929-106401951 CCTATTCAACATAGTGTTGGAAG 0: 8499
1: 5117
2: 3568
3: 2773
4: 2158
Right 1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG 0: 1
1: 11
2: 2856
3: 4583
4: 1371
1101622425_1101622435 22 Left 1101622425 12:106401914-106401936 CCCTCTCTCACCACTCCTATTCA 0: 10185
1: 5655
2: 3179
3: 2674
4: 3101
Right 1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG 0: 1
1: 11
2: 2856
3: 4583
4: 1371
1101622426_1101622435 21 Left 1101622426 12:106401915-106401937 CCTCTCTCACCACTCCTATTCAA 0: 10545
1: 6573
2: 4267
3: 3542
4: 3345
Right 1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG 0: 1
1: 11
2: 2856
3: 4583
4: 1371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101622435 Original CRISPR CAGGGCAATCAGGCAGTTGA AGG Intronic
Too many off-targets to display for this crispr