ID: 1101623701

View in Genome Browser
Species Human (GRCh38)
Location 12:106417355-106417377
Sequence CTGGAGACCCAGGTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 658}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101623701 Original CRISPR CTGGAGACCCAGGTGGAGGC TGG Intronic
900081583 1:862574-862596 CTGCAGACCCAGGTCTAGGGAGG - Intergenic
900086349 1:899614-899636 TTGGAGACCCAGGACGAGCCTGG + Intergenic
900368035 1:2319456-2319478 CTGGTGACCCAGGTCGGAGCAGG + Intergenic
900395107 1:2450282-2450304 CTGGAGGCCCACGGGGAGGGAGG - Intronic
900397877 1:2460668-2460690 CTGATGACCCTGGTGGAGGCTGG + Intronic
900796445 1:4711442-4711464 CTGGGGTCCCAGGTGGAGGCCGG + Intronic
900805955 1:4768642-4768664 ATGGAGCCCCAGGCGGAGACAGG + Intronic
901613120 1:10515064-10515086 CTGGAGAGCCCGCTGGAGGACGG - Intronic
901756430 1:11444224-11444246 CTGCAGAGCCAGGAGGATGCTGG - Intergenic
902205531 1:14865625-14865647 CTGGAGAGCAAGGGGGAGGGTGG - Intronic
902214366 1:14924839-14924861 CTGGAGACCCAGCTCCGGGCTGG + Intronic
902288740 1:15423162-15423184 CTCCAGCTCCAGGTGGAGGCTGG + Intronic
902681292 1:18045740-18045762 CTACTGACCCAAGTGGAGGCAGG + Intergenic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
903878233 1:26490856-26490878 CTGGAGACTGGGGTGGAGGTTGG + Intergenic
904627338 1:31814509-31814531 CTGGAGAGCCAGGTGGAAGTGGG - Exonic
904756170 1:32770011-32770033 CTGGAGGCGGAGGCGGAGGCTGG + Exonic
904812362 1:33171737-33171759 TTGGAAACCAAGGTGGAGGGAGG - Intronic
905018465 1:34793035-34793057 CGGGCGGCCCAGGTGGAGGTGGG - Exonic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905448607 1:38043460-38043482 CTGGTGACCCAGGCCGAGGTGGG + Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906239991 1:44236960-44236982 CTGGAGTCCCTGGAGGAGGTGGG - Intronic
906657361 1:47558433-47558455 GTGGAGACACAGGTGTAGACAGG + Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906895217 1:49763703-49763725 CTGGAGGCCCTGGGGGAGTCAGG - Intronic
908356417 1:63328210-63328232 CCGGGGACACAGGTGGAGTCCGG - Intergenic
908886369 1:68793706-68793728 ATGGAGACCAAAGTGGAGCCTGG + Intergenic
910458336 1:87422076-87422098 GTGAAGACCCAGGTGGAAGATGG - Intergenic
910777895 1:90893900-90893922 CAGGAGTCACACGTGGAGGCCGG - Intergenic
911089823 1:94009566-94009588 CTGGAAACACATGCGGAGGCTGG - Intronic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
913070577 1:115294824-115294846 CTGGAGAGCCAGGAAGAGCCAGG + Intronic
913135458 1:115884179-115884201 GTGGAAACCCAGGTGGGGCCAGG - Intergenic
913366799 1:118048012-118048034 CTGCAGAGTCAGGTGCAGGCTGG + Intronic
913536229 1:119775316-119775338 CTGGAGCCTGAGGTGGAGGATGG + Intergenic
914315631 1:146508861-146508883 GTGAAGACCCAGGTGGAAGATGG - Intergenic
914498724 1:148224500-148224522 GTGAAGACCCAGGTGGAAGATGG + Intergenic
914804702 1:150983481-150983503 CTGTAGACCAAGGAGGAGCCAGG + Intronic
915362520 1:155294719-155294741 CTGGTGACCCAAGTGGAGAACGG - Exonic
916011936 1:160714117-160714139 CTGGTGCCCAAGGTGGAAGCAGG - Intergenic
916052960 1:161048964-161048986 CCAGAGACCAAGGTGGAGGCTGG - Exonic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
917509415 1:175657996-175658018 CTGGGAACCCAAGTGGAGGTAGG - Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
918856772 1:189765637-189765659 CTGTAGACCCAGGCTGAGACAGG - Intergenic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
919682476 1:200449685-200449707 CTGGAACCCGGGGTGGAGGCAGG - Intergenic
919766027 1:201127805-201127827 CTGCAGTCCCTGGTGGAGGCTGG - Intergenic
919910680 1:202108870-202108892 GTGGTGACCTTGGTGGAGGCAGG - Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
921618090 1:217295734-217295756 TGGGAGAACCAGGTGGAGGGAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922338668 1:224638229-224638251 CTGCGCACCCAGGGGGAGGCCGG + Intronic
923445739 1:234069670-234069692 CTGAGGACCCTGGGGGAGGCTGG - Intronic
923966133 1:239140983-239141005 CGGAAGCCACAGGTGGAGGCAGG - Intergenic
923969949 1:239189219-239189241 CTCGATTTCCAGGTGGAGGCTGG - Intergenic
924042413 1:239997479-239997501 CTGAAGGCCCAGGTGGTGACCGG - Intergenic
924048085 1:240052894-240052916 TGGGAGACGGAGGTGGAGGCGGG + Intronic
924643935 1:245859652-245859674 CTGGAGACCAAGGAGGGTGCAGG + Intronic
1062837616 10:646305-646327 GTGGAGAGCCTGGGGGAGGCTGG - Intronic
1062897643 10:1116362-1116384 GTGGAGACCCAGGGTGAGGTGGG - Intronic
1063233638 10:4090204-4090226 CTGGATACCCAGGTTGAGAGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1065016609 10:21468225-21468247 GTGGAGCCCCTGGAGGAGGCAGG - Intergenic
1065128935 10:22601323-22601345 CTGGGGTCCCAGGTGGGGGCAGG + Intronic
1065895464 10:30159381-30159403 CAGGAGAGCAAGGTGGAGGGTGG - Intergenic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1066705648 10:38175102-38175124 TTGGAGAAAGAGGTGGAGGCAGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067533868 10:47093961-47093983 CTGTTGCCCCAGGTGAAGGCAGG - Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070500016 10:77063814-77063836 GTGGATACCCAGGTGGACTCAGG + Intronic
1070515056 10:77197343-77197365 GTGCACACCCAGGTGGAGTCAGG + Intronic
1070785677 10:79160971-79160993 CTGGGGTCTCAGCTGGAGGCTGG - Intronic
1071573702 10:86711458-86711480 CCGGAGAGGGAGGTGGAGGCAGG - Intronic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1074064223 10:109998615-109998637 CAGGAGAGCTAGGTGGGGGCTGG - Intronic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1075710030 10:124525940-124525962 AGGGGGTCCCAGGTGGAGGCCGG + Intronic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076190505 10:128479924-128479946 CTGGCGATCCAGATGGAAGCAGG - Intergenic
1076220805 10:128731708-128731730 CTGGGGACCGTGGTGGGGGCTGG + Intergenic
1076250850 10:128982774-128982796 CTGGATGCCCAGGTTGAGCCAGG + Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076353175 10:129832568-129832590 CAGGAGACCCACTGGGAGGCTGG + Intergenic
1076402974 10:130195365-130195387 CCGGAAACCCAGGTGCAGGCAGG + Intergenic
1076404622 10:130203735-130203757 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404630 10:130203754-130203776 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404638 10:130203773-130203795 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076514010 10:131033062-131033084 CTGCACACCCAGGTGCAGACTGG - Intergenic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1076758185 10:132586109-132586131 CTGGAGACCCGGGCAGAGACTGG + Intronic
1076761888 10:132610159-132610181 TTGGAGCCCCAGGTAGAGCCTGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076903341 10:133350538-133350560 CATGTGACCCAGGTGGAGGAGGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077047672 11:553564-553586 CTCCAGACACCGGTGGAGGCGGG + Intronic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077102608 11:828838-828860 CTGGAGACCCTGGTCGGGGAAGG - Exonic
1077159352 11:1105650-1105672 GTGGACACCCAGGAGGAGGCAGG - Intergenic
1077201227 11:1308834-1308856 ATGGCCCCCCAGGTGGAGGCGGG - Intronic
1077201270 11:1308940-1308962 ATGGCCCCCCAGGTGGAGGCGGG - Intronic
1077201295 11:1309010-1309032 ATGGTCCCCCAGGTGGAGGCGGG - Intronic
1077315434 11:1917538-1917560 CTGTAGACCTGGGTGGGGGCAGG - Intergenic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1077792979 11:5461434-5461456 GTGGAGACCCTGGGAGAGGCTGG + Intronic
1078103944 11:8346584-8346606 CGGGAGCCTCAGGTGGAAGCCGG - Intergenic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078537522 11:12186926-12186948 CTTGAGAACCAGGTGTAGGAGGG - Intronic
1079241962 11:18727796-18727818 CTGGAGCCCCTTGTGGAGACTGG - Intergenic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1079914529 11:26352291-26352313 CTTGAGATCTAGCTGGAGGCTGG + Intronic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1083281674 11:61630501-61630523 GTGGAGACGGAGGTGGAGGTGGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083298748 11:61729123-61729145 CTGGAGAGCCGGGGGGAGACCGG - Intronic
1083323882 11:61863614-61863636 CTGGAGACCCTGGGTAAGGCTGG + Intronic
1083675727 11:64323664-64323686 CAGGGGTCCCAGGTGGGGGCAGG + Intergenic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084040166 11:66538014-66538036 TGGGAGACGGAGGTGGAGGCAGG + Intronic
1084531310 11:69729465-69729487 CTGGGGTCCCTGGTGGAGGAGGG - Intergenic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1085051075 11:73380593-73380615 CTGGAGACCAGGCTGGGGGCTGG - Intronic
1085134558 11:74074363-74074385 CAGGGGACCTGGGTGGAGGCAGG + Exonic
1085467638 11:76734998-76735020 CAGGAGCCCCAGGTGCAAGCCGG + Intergenic
1085641625 11:78196550-78196572 CTGCAGACCCAGCTGCACGCAGG - Exonic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085779918 11:79398816-79398838 CTGGGGGCCCAAGTAGAGGCTGG + Intronic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088824523 11:113482675-113482697 CTGGAGAGTCAGGTGGGAGCTGG + Intergenic
1088980403 11:114858137-114858159 GGAGAGAGCCAGGTGGAGGCAGG - Intergenic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089973842 11:122715817-122715839 CAGGGGACCACGGTGGAGGCTGG - Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1091979410 12:4853309-4853331 CTCGAGAGAAAGGTGGAGGCTGG - Intergenic
1092003794 12:5052040-5052062 CTGGGGATCCTGGAGGAGGCAGG + Intergenic
1092451420 12:8605860-8605882 CTGGACCACTAGGTGGAGGCAGG + Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1095521901 12:43076454-43076476 ATGGAGACCCAGCTCAAGGCGGG + Intergenic
1095913216 12:47449644-47449666 CTGGAGGCCATTGTGGAGGCTGG - Intergenic
1095969979 12:47894877-47894899 GTGGATCCACAGGTGGAGGCAGG - Intronic
1096198577 12:49664925-49664947 GTGGAGGCCCAGGTGGGGGTGGG - Intronic
1096238380 12:49944983-49945005 GTTGAGGCCCAGGTGGAGGCAGG - Intergenic
1096681736 12:53260123-53260145 CTGGAGGCTGAGGTGGAGGTGGG - Intergenic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098951481 12:76644881-76644903 CTTGAGAGCCAGGAGCAGGCAGG + Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101680015 12:106955803-106955825 CTGGAGCCGCGGGAGGAGGCGGG + Exonic
1101913969 12:108882138-108882160 CTGGACACCCAGGTGGTGAGAGG - Intronic
1102144731 12:110646173-110646195 CCGGCAACCCAGGTAGAGGCAGG + Intronic
1102454580 12:113063676-113063698 CTGGAGTGGCAGGTGGTGGCTGG + Intronic
1102566608 12:113801356-113801378 CTGGACCCCCAGCTGAAGGCCGG - Intergenic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1104636069 12:130438447-130438469 CAGGAGACCCGGATGGTGGCGGG + Exonic
1104866923 12:131961317-131961339 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1104885472 12:132104685-132104707 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1104920794 12:132289722-132289744 ATGGAGCCCCGGGTGGAGGGAGG - Intronic
1105443926 13:20436563-20436585 CTGAAGGCCCAGGAAGAGGCTGG - Intronic
1106393020 13:29354067-29354089 CAGGGGACTCAGGTGGAGCCTGG - Intronic
1106922030 13:34574178-34574200 CTGGAGCACCAGGTCCAGGCTGG + Intergenic
1107958885 13:45542073-45542095 AAGGAGCCCAAGGTGGAGGCGGG - Intronic
1108302994 13:49099226-49099248 CTAGAGATCAAGGTGGAAGCTGG - Intronic
1110596501 13:77326462-77326484 CTGGGGACGCACCTGGAGGCTGG + Exonic
1111976117 13:94968379-94968401 CTGGAGACCCGGGAGGAGCGAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112740997 13:102472512-102472534 CTGCAGACCCAGGAAAAGGCAGG - Intergenic
1112777980 13:102866370-102866392 CTGGAAAGCCAGGTGGGTGCAGG + Exonic
1113228100 13:108180829-108180851 CTGGAGACCCAGGTATCGGCTGG - Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1114554721 14:23555485-23555507 TTGGAGACCTAGATGGAGACAGG - Intronic
1119025453 14:71148806-71148828 CTGTAGACCCTGGTGAGGGCTGG - Intergenic
1119164394 14:72480327-72480349 GAGGAAACCAAGGTGGAGGCGGG + Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119642748 14:76327229-76327251 CTGGGGACCCACGTGGGGGTGGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120768222 14:88351270-88351292 CTGGAGATCAAGGTGTTGGCTGG + Intergenic
1121173453 14:91873086-91873108 GGGTGGACCCAGGTGGAGGCCGG - Intronic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122891750 14:104735247-104735269 CTGGTGGGGCAGGTGGAGGCTGG - Intronic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1125385352 15:39130929-39130951 CTGGAGGCAAAGGTGGGGGCGGG - Intergenic
1126256780 15:46636618-46636640 CTGGACACCCAGGATGAGACTGG - Intergenic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128638503 15:69318368-69318390 TTTAACACCCAGGTGGAGGCAGG + Intronic
1128679242 15:69635828-69635850 TTGGACAGCCTGGTGGAGGCTGG + Intergenic
1129060497 15:72856904-72856926 CAGGAGCCCCTGGTGGAGGGAGG - Intergenic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1131541780 15:93280602-93280624 GAGGAGACCCAGGCAGAGGCAGG - Intergenic
1131983347 15:98017228-98017250 CAGGAGACCAATTTGGAGGCTGG - Intergenic
1132313432 15:100873926-100873948 GTGGAGACCAAGGTGGGGGATGG - Intergenic
1132645482 16:997493-997515 CTGGACACCGTGGAGGAGGCGGG - Intergenic
1132650926 16:1021154-1021176 AGGGGGACCCAGGTGGAGGCGGG + Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132973838 16:2701847-2701869 CTGGTGACCCGGAGGGAGGCAGG + Intronic
1133199066 16:4191314-4191336 CTCAAAACCCAGGTGGAGGCCGG + Exonic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133277307 16:4646742-4646764 CTGGGGGCCCTCGTGGAGGCTGG + Intronic
1133387941 16:5385887-5385909 CTGGAGAGACAAGTGGGGGCAGG + Intergenic
1134051379 16:11140209-11140231 CCGGAGACCCAGCTGTGGGCCGG - Intronic
1134241825 16:12512265-12512287 CTGGAGAGGCAGGTGGGAGCTGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134666645 16:16023734-16023756 CTGGAGCCCCAGGCTGAGTCAGG - Intronic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135848115 16:25937614-25937636 CTGGAGGGCTAGGTGGAAGCTGG + Intronic
1136547713 16:30965052-30965074 CTCCAGAACCTGGTGGAGGCGGG + Exonic
1137556759 16:49475066-49475088 CTGGAAACCGTGGGGGAGGCAGG + Intergenic
1137562382 16:49511048-49511070 GTGGAGGCCCAGGTGGGGACTGG - Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138514038 16:57526130-57526152 GCGGGGACCAAGGTGGAGGCTGG + Intronic
1138564246 16:57821234-57821256 ATGCAGACCCAGGTAGAAGCTGG + Intronic
1139062058 16:63264127-63264149 CTGGAGGCCCTGGTGGAAGGGGG + Intergenic
1139581607 16:67877115-67877137 CTTGAGACTCTGGTGGTGGCAGG + Intronic
1139657640 16:68398511-68398533 CTGGAGAACAAGGTGAAGGTTGG - Intronic
1139908114 16:70380562-70380584 ATGGAGAGCAGGGTGGAGGCAGG + Exonic
1140091799 16:71845567-71845589 TTGGGGACCCAGGTGGAGATAGG - Intergenic
1141436136 16:84000949-84000971 CAGTAAACCCTGGTGGAGGCAGG + Intronic
1141710585 16:85696697-85696719 CAGGAGACTCACCTGGAGGCAGG + Intronic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142149602 16:88506764-88506786 GGGGGGACCCAGGAGGAGGCAGG + Intronic
1142496620 17:309592-309614 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142496660 17:309705-309727 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142685166 17:1573368-1573390 ATGGAGCCGCACGTGGAGGCTGG + Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143036283 17:4001115-4001137 CTGAAAACCCAGGTGGAAGCAGG + Intergenic
1143100699 17:4503209-4503231 CAGGAGCCCCAGGTGGAGGTAGG + Intronic
1143237637 17:5417075-5417097 TAGGAGGCCAAGGTGGAGGCAGG - Intronic
1143240481 17:5439232-5439254 CTGGAGACTCCGGTGCAGCCCGG + Intronic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1145974169 17:28974810-28974832 TGGGAGACCCAGGCGGAGACCGG - Intronic
1145978616 17:28998412-28998434 CTGGGGACCCAGGGGTAGGGAGG + Intronic
1146362004 17:32184742-32184764 TTGGAGGCAGAGGTGGAGGCGGG - Intronic
1146370211 17:32261429-32261451 CTGGAGATGGAGGTGGAGGGTGG + Intergenic
1146846468 17:36184212-36184234 CTGGAGGGCCTGGGGGAGGCTGG + Intronic
1147155260 17:38541540-38541562 ATGGAGACCTGGGTGGGGGCAGG + Intronic
1147268002 17:39246496-39246518 CTCGAGACCTGGGAGGAGGCTGG + Intergenic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1148084739 17:44987402-44987424 ATGGAGGCCTGGGTGGAGGCAGG - Intergenic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1148977739 17:51544443-51544465 CTGGAGAGCCTGGTTGGGGCAGG - Intergenic
1149301167 17:55305594-55305616 CTAGAAAGCCAGGGGGAGGCTGG - Intronic
1149654090 17:58301299-58301321 CTGGAGACCAAGGTCAAGGTGGG + Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149849815 17:60027605-60027627 CTGGAGGGCCTGGGGGAGGCTGG + Intergenic
1149860353 17:60118919-60118941 CTGGAGGGCCTGGGGGAGGCTGG - Intergenic
1150133538 17:62681781-62681803 GTGGAGGCCCAGCTGGGGGCCGG + Intronic
1150438703 17:65174045-65174067 ATGGAGAGCCAGGTTGGGGCTGG + Intronic
1150654883 17:67033144-67033166 CCGGAGACCCAGCTGGCCGCGGG - Exonic
1151386852 17:73760258-73760280 CTGGGGAGGCAGGTGGATGCTGG + Intergenic
1151470193 17:74313281-74313303 CTTTAGACCCAGGGGGAGGGAGG - Intronic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151700042 17:75737934-75737956 CTGGGGACCCTGGTGGGGGTTGG - Intronic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1152063746 17:78098483-78098505 CTGGCACCCCAGGTGGAGGAGGG - Exonic
1152067404 17:78119202-78119224 CTGTGGCCCCAGGGGGAGGCAGG + Intronic
1152070617 17:78132116-78132138 CGGGGGACCCGGGTGAAGGCAGG - Intronic
1152096688 17:78276770-78276792 CTGGGGACCCAGGTGGCAACCGG - Intergenic
1152170467 17:78743327-78743349 CTGGAGACCAGTGTGGAGTCTGG - Intronic
1152537641 17:80959886-80959908 CAGGAGTCCCAGGGAGAGGCAGG - Intronic
1152809708 17:82375666-82375688 CTGGAGACCCTCAGGGAGGCGGG - Intergenic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1155053048 18:22165007-22165029 CTGGAGCTCCAGGTGGGAGCTGG - Intergenic
1155341324 18:24817393-24817415 GAGGTGACCCAGCTGGAGGCGGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1157435751 18:47667808-47667830 CTGGAGCCCGAGGTGGGTGCTGG + Intergenic
1157502796 18:48202901-48202923 CTGGAGACTTCTGTGGAGGCAGG - Intronic
1157701493 18:49763838-49763860 CTGAATAACCAGCTGGAGGCAGG - Intergenic
1157753073 18:50195188-50195210 CCGGAGGCCCAGGTGGCAGCGGG - Intergenic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1158770619 18:60512782-60512804 AAGTAGACCCAGGAGGAGGCTGG - Intergenic
1159087251 18:63807811-63807833 CAGGAGCCCCTGGTGGAGGTGGG - Intergenic
1159656131 18:71031650-71031672 CTGGAGTTCCAGGTGGGGGTGGG - Intergenic
1160345586 18:78129240-78129262 CTGGAGATCAAGGTGTCGGCAGG - Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160949472 19:1658562-1658584 TGGGAGACCGAGGTGGAGGCCGG + Intergenic
1161241492 19:3225781-3225803 CTTGAGCCCAAGGTGGAGGCGGG - Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161524928 19:4748326-4748348 CTGGTGACCCGGGAGTAGGCTGG - Intergenic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1162019503 19:7862266-7862288 CTTGAGACGCAGGTGGACTCGGG + Exonic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162360955 19:10220116-10220138 TGGGAGGCCAAGGTGGAGGCAGG + Intronic
1162554111 19:11375747-11375769 CTCCAGACCCAGGAGGAAGCAGG + Exonic
1162901399 19:13797011-13797033 CTAGAAACCCAGGTGGAGTAGGG + Intronic
1163250684 19:16124818-16124840 CTGTGGACCCAGGCTGAGGCGGG + Intronic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1163669887 19:18621147-18621169 CTGGAAACCCAGGTGGCACCAGG + Intergenic
1163849829 19:19656582-19656604 GTGGAGGCCCAGGGGGTGGCGGG - Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1164626731 19:29734269-29734291 CTGGAAACCCAGGGGGTGGCGGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165139694 19:33691196-33691218 CTGGGGACCCAGGGGACGGCTGG + Intronic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165476295 19:36032739-36032761 CTGGGGACCAAAGTGGAGACTGG + Exonic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166113980 19:40641520-40641542 CTGGAGTCCAGGGAGGAGGCCGG + Intergenic
1166305106 19:41932914-41932936 CTGGAGACAGATGTGGGGGCTGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166356049 19:42228088-42228110 CTGGAGGCTGAGGCGGAGGCAGG + Exonic
1166501295 19:43343527-43343549 CTGGTGTCCCCCGTGGAGGCAGG + Intergenic
1166520641 19:43477991-43478013 TTGGAGACTCAGTTGGAGTCAGG - Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166871902 19:45876441-45876463 CCAGAGACCCAGGTGGAGGGAGG - Intergenic
1167439410 19:49499831-49499853 AAGGAGACCCAGGGGAAGGCAGG - Intergenic
1167466178 19:49652025-49652047 TTGGAGTCCCAGGGCGAGGCCGG - Exonic
1167609845 19:50501776-50501798 CAGGAGGCCCGGGAGGAGGCTGG - Intergenic
1168266953 19:55228515-55228537 CTGGGGTCCCAGGTGGGGGTGGG - Intronic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
924999271 2:392260-392282 TGGGAGACCGAGGTGGAGACAGG - Intergenic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925691123 2:6524544-6524566 CTGGGGACCAGGTTGGAGGCTGG + Intergenic
926118062 2:10225723-10225745 CTGGCGGCCCAGGTGCAGGGAGG - Intergenic
926326906 2:11792871-11792893 GAGGAGACCCAGGTGGACACAGG - Intronic
926581349 2:14634566-14634588 CTTGAGGCCCAGGTGGCCGCAGG - Exonic
927640303 2:24841526-24841548 CTGGAGAGCCAGGCGGGGCCAGG + Intronic
927736356 2:25526055-25526077 CAGGAGCCCCAGGTGGAGGCAGG + Intronic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929955321 2:46453834-46453856 ATGGAGAGCCAGGTAGAGTCAGG - Intronic
930191419 2:48463813-48463835 CAGTAGACCGAGGTGGAGGGTGG + Intronic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
932572062 2:72943351-72943373 GTGGAGACCCCGGGGGAGGGAGG + Exonic
933438778 2:82282886-82282908 CCGCAGACCTAGGTGAAGGCAGG - Intergenic
934928261 2:98397163-98397185 CTGGAAAGCCAGGTGAAGGGTGG + Exonic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
935951381 2:108332377-108332399 CTGCAGACATAGGTGAAGGCTGG - Intergenic
936117406 2:109713078-109713100 CAAGAGACCCAGGTGGAGGAAGG - Intergenic
936159402 2:110072214-110072236 CTGGGGAGCCCGCTGGAGGCGGG - Intergenic
936185259 2:110299118-110299140 CTGGGGAGCCCGCTGGAGGCGGG + Intergenic
936450695 2:112631925-112631947 CTGGGGTACCAGGTGGAGTCTGG - Intergenic
937116894 2:119413021-119413043 CTGTAGTCCCAGGCAGAGGCAGG - Intergenic
937285892 2:120750934-120750956 CTGCAGAGCAAGGTAGAGGCAGG - Intronic
938260582 2:129892567-129892589 AAGGAGACCCAGGTCGGGGCAGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938877627 2:135549447-135549469 CGGGAGACGGAGGTTGAGGCAGG + Intronic
942401607 2:175609182-175609204 GTTGAGACCGAGGTGGGGGCCGG - Intergenic
943435976 2:187866598-187866620 CTGGAGACCCAGGGGGGAGCTGG - Intergenic
943436017 2:187866854-187866876 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436024 2:187866910-187866932 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436165 2:187867944-187867966 CTGGAGACCAAGGGGGGAGCTGG - Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
943897107 2:193378293-193378315 CTGGAGACCCCAATGGTGGCAGG + Intergenic
944772209 2:202925832-202925854 AAGGAGAGCCAGGTGGAGTCTGG + Intronic
944921741 2:204421298-204421320 CTGGAGGTGGAGGTGGAGGCTGG - Intergenic
945180647 2:207087727-207087749 CTGCAGGCCAAGGTGAAGGCAGG - Intronic
945859645 2:215106026-215106048 CTGGAGAGCAAGGTGCAGTCTGG + Intronic
945859833 2:215108017-215108039 CTGGAGAGCAAGGTGCAGTCTGG - Intronic
946009079 2:216550298-216550320 CTGGAAAGCCAGGCAGAGGCAGG - Intronic
946707873 2:222476383-222476405 TTGAAGTCCCAGGTGGAGCCAGG - Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947628334 2:231635161-231635183 CTGCAGACCCAGGGAGGGGCTGG + Intergenic
948443377 2:238012760-238012782 CTGGTGCCCTAGGTGGAGGAAGG + Intronic
948693662 2:239722087-239722109 CTGGATATACAGGTGGGGGCTGG + Intergenic
949008823 2:241667132-241667154 GTGGAGACCCGGGAGGGGGCGGG - Intronic
949071103 2:242024800-242024822 CTGGAGACCCAGGGAGGAGCTGG + Intergenic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1169217896 20:3803983-3804005 GTGGCAACCCAGGAGGAGGCAGG - Intronic
1169411299 20:5372583-5372605 GGGGTGACCCAGGTAGAGGCTGG - Intergenic
1169469743 20:5873941-5873963 GTGGATTCCTAGGTGGAGGCTGG + Intergenic
1170033677 20:11968234-11968256 CTGGAGACCCTGGTTGGGGAGGG + Intergenic
1171182584 20:23101847-23101869 CATGAGATCCAGGTGGATGCTGG - Intergenic
1171339655 20:24417474-24417496 CTGAAGACACAGGTGCGGGCGGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172094063 20:32452178-32452200 CTGCAGACCCAGCTGGGTGCTGG + Intronic
1172581263 20:36050666-36050688 CGGGAGACCCGGGTGCCGGCGGG + Intergenic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173704533 20:45100339-45100361 GTGGAGATCCAAGTGGAGGTGGG - Exonic
1173737475 20:45372411-45372433 AGGGAGCCCCAAGTGGAGGCTGG - Intronic
1174060940 20:47832698-47832720 CTGGAGACCCAGGGAGTAGCCGG - Intergenic
1174061087 20:47833592-47833614 CTGGAGACCCAGGGTGGAGCCGG + Intergenic
1174061222 20:47834302-47834324 CTGGAGACCCAGGTAAGAGCTGG - Intergenic
1174061279 20:47834711-47834733 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174070248 20:47894612-47894634 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1174070554 20:47896397-47896419 CTGGAGACCCAGGTAAGAGCTGG + Intergenic
1174070689 20:47897107-47897129 CTGGAGACCCAGGGTGGAGCCGG - Intergenic
1174070839 20:47897926-47897948 CTGGAGACCTGGGGAGAGGCCGG + Intergenic
1174070957 20:47898672-47898694 CTGGAGACCCAGGGAGTAGCCGG + Intergenic
1174100143 20:48121110-48121132 CTGGAGACCCAGGGAGTAGCTGG - Intergenic
1174100311 20:48122065-48122087 CTGGAGACCTGGGGAGAGGCCGG - Intergenic
1174100324 20:48122118-48122140 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174100410 20:48122622-48122644 CTGGAGACCCAGGGTGGAGCCGG + Intergenic
1174100477 20:48122981-48123003 CTGGAGACCTGGGGAGAGGCCGG - Intergenic
1174100565 20:48123481-48123503 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1174100637 20:48123900-48123922 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174148864 20:48472040-48472062 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1174149549 20:48476467-48476489 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174153100 20:48499987-48500009 CTGGAGACCCAGGGGGTAGCCGG - Intergenic
1174153191 20:48500515-48500537 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174153200 20:48500568-48500590 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174153370 20:48501549-48501571 CTGGAGACCCAGGGTGGAGCCGG + Intergenic
1174153428 20:48501854-48501876 CTGGAGACCTGGGTAGAGGCTGG - Intergenic
1174153439 20:48501907-48501929 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1174156146 20:48516614-48516636 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1175161835 20:57013970-57013992 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1175169122 20:57067612-57067634 CTGGAGACCCAGGAGGATCTGGG + Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175597028 20:60243465-60243487 CTGGAAATCCAGGTGTGGGCAGG + Intergenic
1175709791 20:61210319-61210341 CTGGAGCCTCAGGTGGGGTCAGG - Intergenic
1175912334 20:62410855-62410877 CTGTGGACCCTGGTGCAGGCTGG + Exonic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176091528 20:63320553-63320575 CTGGAGGCCCTGGGGCAGGCTGG + Intronic
1176190072 20:63804294-63804316 CTGGGCACCCAGGAGGGGGCCGG + Intronic
1176191631 20:63813571-63813593 CAGTAGAACCAGGTAGAGGCGGG - Intronic
1176288806 21:5033732-5033754 CTGGACACCCTGGTCGGGGCTGG - Intronic
1176671350 21:9738032-9738054 CTGGAGTCCCTGTTGGATGCTGG + Intergenic
1177196820 21:17912094-17912116 CTGGAGACTGGGGTGGGGGCTGG - Intronic
1177830824 21:26137044-26137066 CAGGAGGCGGAGGTGGAGGCGGG - Intronic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1179022967 21:37656560-37656582 CTGCAGAGCCATGGGGAGGCTGG - Intronic
1179868376 21:44229743-44229765 CTGGACACCCTGGTCGGGGCTGG + Intronic
1180006300 21:45022538-45022560 CTGGAGGCCCGGGTGGAAGACGG + Intergenic
1180176517 21:46093078-46093100 CTGGGAACCCTGGTTGAGGCTGG + Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181640049 22:24191518-24191540 CAGGAGACCTAGTGGGAGGCTGG - Intergenic
1181694454 22:24585932-24585954 GTGGAGTCCCAGGTGGAGGCAGG + Exonic
1181830725 22:25558395-25558417 ATGCAGATCCAGTTGGAGGCAGG - Intergenic
1182318245 22:29462138-29462160 CTGCAGACCCAGGTGCAGAGTGG + Intergenic
1182784594 22:32896960-32896982 CTGGAGACCAGGGTGGGGACAGG - Intronic
1183410737 22:37653804-37653826 CTGGTGACCTTGGGGGAGGCTGG - Exonic
1183586405 22:38755608-38755630 CCGCGGACCCGGGTGGAGGCTGG + Intronic
1183670786 22:39271277-39271299 CTGGAGGCCCAGGTCTCGGCAGG + Intergenic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184668561 22:46001202-46001224 CTGGAGAGCCAGGCAGATGCAGG + Intergenic
1184742640 22:46438000-46438022 CTTTGGACCCAGGTGGGGGCTGG + Intronic
1184812917 22:46849235-46849257 CTGGAGACCCACTTGGACGGAGG - Intronic
1184830968 22:46986892-46986914 CTGGAATCTCAGGTGGTGGCTGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1185119137 22:48955356-48955378 CAGGAGACCCACCTGGAGCCTGG - Intergenic
1185247446 22:49780658-49780680 CTGGTGGTCCAGGTGGAGGCTGG - Intronic
949158915 3:858038-858060 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950221017 3:11196185-11196207 CTGGAGACTTAGGCAGAGGCTGG - Intronic
950414429 3:12860537-12860559 GTGCAGCCCTAGGTGGAGGCTGG + Intronic
950646820 3:14382316-14382338 CAGGAGACCATGGAGGAGGCTGG + Intergenic
950850847 3:16060933-16060955 GTAGAGACTCTGGTGGAGGCAGG + Intergenic
950971680 3:17195384-17195406 CTGGAGGCCCTGGTGCTGGCTGG - Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
953158675 3:40398167-40398189 CTGCAGACCCTGGTGAAAGCTGG + Intronic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
953976244 3:47383751-47383773 CTGGAGGCCCAGGTGCATGGAGG - Intronic
954415116 3:50389585-50389607 GTGTTGACCCAGGTGCAGGCAGG - Intronic
955331129 3:58048344-58048366 CTGGAGAACAGGGTGGAGCCTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955779602 3:62470287-62470309 GTTGGGACCCAGGTGGAGGCTGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956722551 3:72131215-72131237 CTGGAGCACCAGGTGTAGTCAGG + Intergenic
958727192 3:97920423-97920445 CTGAAGACCCATGTGGAATCTGG - Intronic
960814555 3:121659480-121659502 CTGAAGGCCTAGGTGGAGACAGG - Intronic
960988466 3:123295503-123295525 CTGGAGAGCCAAGTGCTGGCTGG + Intronic
961126297 3:124421154-124421176 CTGCAGAGCCAGGTGGACTCAGG + Intronic
961443184 3:126965020-126965042 CTGCAGCCCCAGGTGGCGGGAGG - Intergenic
961651155 3:128417312-128417334 CTGGAGACCTAGGAGGAGTGGGG - Intergenic
961661803 3:128473012-128473034 TGGGAGGCCCAGGAGGAGGCTGG + Intergenic
961721393 3:128899058-128899080 ATGGATGGCCAGGTGGAGGCGGG - Intronic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962963797 3:140335247-140335269 CTGGTGACCCATTTGGTGGCAGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
963985157 3:151584652-151584674 ATGTGGTCCCAGGTGGAGGCTGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
966405026 3:179587744-179587766 CTGGAGTCCCAGGCTGAGGTGGG + Intronic
966624964 3:182005860-182005882 CTGGAGAGGCAGCTCGAGGCAGG + Intergenic
966854751 3:184186306-184186328 GGGGAGACCGAAGTGGAGGCCGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968815377 4:2818818-2818840 CGGGTGACCCAGGCCGAGGCCGG + Intronic
969429832 4:7147663-7147685 CTGGAGATCCAGGTAGGAGCTGG - Intergenic
969482857 4:7456001-7456023 CTTGAGACCAAGGTGTAGGCAGG + Intronic
969511839 4:7622542-7622564 CTGGAGTCCCAGGCAGGGGCTGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969602117 4:8182726-8182748 CTGGTGACCCTGGAGGACGCAGG + Intronic
969973543 4:11073435-11073457 CTTGAGCCCCAGGTGGAAACAGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
974238818 4:59216431-59216453 CTGAGAACCCAGGTGGGGGCTGG + Intergenic
975992834 4:80278380-80278402 CTGGAGACCCAGGAGTAGATGGG - Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
980963639 4:139500308-139500330 GTAGGGACCCAGGTGGAAGCAGG - Intronic
980992925 4:139753938-139753960 CTGGAGACTGGGGTGGAGGGAGG + Intronic
982854982 4:160370376-160370398 CTTGAGACCCAGGTTATGGCTGG + Intergenic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
985403376 4:189613761-189613783 CTGGAGTCCCTGTTGGATGCTGG - Intergenic
985506968 5:286992-287014 CTGGAGACCCAGGGAGGAGCTGG + Intronic
985521536 5:376119-376141 CAGAAGACCCAGGTGGACGCAGG + Intronic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985863823 5:2495719-2495741 CAGGAGACCCAGGCCAAGGCAGG + Intergenic
987989367 5:25190741-25190763 CGGGAGACCCGGGTGCCGGCGGG + Intergenic
988065433 5:26225306-26225328 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
988065763 5:26227909-26227931 CTGGAGACCCTGGAGGAGCTGGG - Intergenic
988434107 5:31153537-31153559 CTGGAGAGCCAGGTTCAGGGAGG - Intergenic
988483433 5:31648504-31648526 CGGGAGAACAAGGTGGAGGCTGG - Intronic
988507107 5:31833170-31833192 CTAGAAACAAAGGTGGAGGCTGG + Intronic
988712760 5:33794590-33794612 ATGGAGACCGAGGTGCAGGTAGG + Intronic
990157163 5:52890164-52890186 ATGGTTACCCAGGTGGAGGAAGG - Intronic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
995687956 5:114791683-114791705 CAGGAGATCCAGGTAGAGGATGG + Intergenic
996893992 5:128457327-128457349 CTGGAGTACCAGGAGGAGACAGG + Intronic
997015641 5:129931161-129931183 ATGGAGACACATGTGTAGGCCGG - Intronic
997530172 5:134577110-134577132 CTGTAGACCTGGATGGAGGCTGG + Intronic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
997883522 5:137611479-137611501 CGGGAGGCCCAGGTGGAGATGGG - Intergenic
998182706 5:139956498-139956520 CTGGGGACCCTGGAGGATGCTGG - Intronic
998216442 5:140241478-140241500 CCAGAGACTCAGCTGGAGGCTGG - Intronic
999246452 5:150157554-150157576 CAGGTGACACAGGTAGAGGCTGG + Intergenic
999429153 5:151511093-151511115 CTGGAGAACAGGGAGGAGGCTGG + Intronic
999721959 5:154405125-154405147 CAGGAGACCCCGGTGCTGGCCGG + Intronic
1000061988 5:157666264-157666286 CTGGAGGCTGAGGTGGAGGTGGG - Intronic
1001120390 5:168975248-168975270 CTGGAGAGCCCGGTGGCTGCAGG - Intronic
1001484668 5:172111089-172111111 CAGGAAACCCAGGTAGAGCCTGG + Intronic
1001936023 5:175706669-175706691 CTTGAGGCCCAGGTGCAGGTGGG + Intergenic
1002033090 5:176445396-176445418 CTGTAGTCCCAGGCCGAGGCAGG - Intergenic
1002093083 5:176816248-176816270 CTGGAGAGCCAGGTGGCTGCTGG + Intronic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003072827 6:2958274-2958296 CCTGAGATCCAGGTGTAGGCAGG - Intronic
1003264924 6:4557204-4557226 CTGCAGACCCAGGAGGAGTTGGG - Intergenic
1003424415 6:5988173-5988195 CTGGAGGCCCTTTTGGAGGCCGG + Intergenic
1005583612 6:27255109-27255131 CTGGCGCCCTAGGCGGAGGCTGG - Exonic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006305160 6:33214187-33214209 CTGGGGACCCGGGAGGGGGCAGG - Intergenic
1006839963 6:37022392-37022414 TGGGTGACGCAGGTGGAGGCAGG - Intronic
1007269370 6:40624472-40624494 CCTGACACCCGGGTGGAGGCGGG - Intergenic
1007398115 6:41588720-41588742 CTGGAGATCCAGGTGTGGCCCGG + Exonic
1007502568 6:42309896-42309918 TTGTAGTCCCAGGTTGAGGCGGG - Intronic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1015640387 6:135325816-135325838 CTGGAGCCCTAGGTGGCTGCTGG + Intronic
1017009283 6:150052470-150052492 CTGGAGACCCAGGGAGTAGCTGG - Intergenic
1017009497 6:150053741-150053763 CTGGAGACCCGGGTAGGAGCCGG - Intergenic
1017009786 6:150055466-150055488 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1017293689 6:152770180-152770202 CTGTTGACCAAGGTTGAGGCAGG - Intergenic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1018739213 6:166714608-166714630 CTGGAGACAGAGGCAGAGGCGGG + Intronic
1018944890 6:168340912-168340934 CCGGGGCCCCAGGTGGATGCAGG + Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019167039 6:170104023-170104045 TGGGAGGCCGAGGTGGAGGCGGG - Intergenic
1019442790 7:1055888-1055910 CTGGGGACTCAAGTGGAGTCTGG + Intronic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1019943384 7:4308480-4308502 CTGGAGATCCAGGTGTCTGCAGG + Intergenic
1020012794 7:4815751-4815773 GGGGAGACCCAGGTGGGGGCAGG - Intronic
1020030442 7:4929163-4929185 ATGGAGTCCCAGCTGGATGCAGG - Intronic
1020763753 7:12296431-12296453 CTGGTGCCCAAGGTGGAAGCTGG + Intergenic
1021844637 7:24752575-24752597 CTGGTATCCCAGGTGCAGGCTGG + Intronic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1022966919 7:35482554-35482576 GGGGAGGCCCAGGTGGAGGTGGG + Intergenic
1023601366 7:41884682-41884704 CTGGAGACCCAGGGAAGGGCTGG - Intergenic
1023992190 7:45134875-45134897 CTGGAGCCCCAGGGCCAGGCTGG + Intergenic
1024050300 7:45616946-45616968 CTGGAGATCCAGGTGATGGTAGG + Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024617863 7:51130654-51130676 GAGGACACCCAGGGGGAGGCAGG - Intronic
1025108576 7:56193696-56193718 GTGGAGACCCATGGGGAGGGAGG + Intergenic
1025233143 7:57216357-57216379 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1025233506 7:57218530-57218552 CTGGAGACCCAGGGAGGAGCTGG + Intergenic
1025233600 7:57219038-57219060 CTGGAGACCTTGGGAGAGGCTGG + Intergenic
1025233652 7:57219346-57219368 CTGGAGACCCAGGGTGGAGCCGG - Intergenic
1025233788 7:57220113-57220135 CTGGAGACCCAGGGAGGAGCCGG + Intergenic
1025233801 7:57220166-57220188 CTGGAGACCTGGGGAGAGGCTGG + Intergenic
1025233997 7:57221318-57221340 CTGGAGACCCAGGGAGTAGCTGG + Intergenic
1026023777 7:66729685-66729707 CAGGAGACCCACCTGGAGACTGG - Intronic
1026888406 7:73967947-73967969 CAGGAGACCCACCTGGAGGCTGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1026971838 7:74473236-74473258 CAGGAGAACCTGGTGGGGGCAGG + Intronic
1027165311 7:75829978-75830000 AGGGAGCCCCAGGGGGAGGCAGG + Intergenic
1027165832 7:75833766-75833788 AGGGAGCCCCAGGGGGAGGCAGG - Intergenic
1027241900 7:76336041-76336063 CTGTAGTTCCAGGTTGAGGCAGG - Intronic
1029281583 7:99439037-99439059 CAGGAGACCGAGGGGGAGCCGGG + Intronic
1029300697 7:99580357-99580379 CTGGAAACGCAGTTGGCGGCGGG + Intronic
1029374688 7:100170586-100170608 AGGGAGACACAGGTGGATGCCGG + Intronic
1031483171 7:122302000-122302022 CTGGTGGCCCTGGTGGAGCCCGG + Exonic
1032458835 7:132094367-132094389 CTGGAGGCTCAAGGGGAGGCTGG - Intergenic
1033657512 7:143383144-143383166 CTGGAGCCCCAGGTGGATCTGGG + Exonic
1034063408 7:148113832-148113854 CTGGAGACCCAGCCCGGGGCTGG - Intronic
1034509736 7:151523961-151523983 GTGAAGACCAAGGTGGAGACTGG + Intergenic
1035068391 7:156123997-156124019 CAGGACACACAGGCGGAGGCAGG + Intergenic
1035100323 7:156390884-156390906 ATGGACACCCAGGTGGACCCAGG - Intergenic
1035286346 7:157809739-157809761 CTGGAGATCCAGGTGTTGTCAGG - Intronic
1035487312 7:159236187-159236209 CTGCAGGCCCAGGAGGAGTCAGG + Intergenic
1035523684 8:294976-294998 CTGCAGACCCAGGTCTAGGGAGG + Intergenic
1036061946 8:5332393-5332415 CTGAAGACCCAGCTCCAGGCCGG - Intergenic
1036780131 8:11641151-11641173 CGGGAGAGTCAGGTGGAGCCTGG - Intergenic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1039032538 8:33325915-33325937 CTGGAAACACAGGTGGGCGCGGG - Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1041740987 8:61156261-61156283 GTGGAGACCCAGGTGATGGGAGG - Intronic
1042298568 8:67250099-67250121 TTGGAGAGGCAGGTGGAGCCAGG + Intronic
1042346052 8:67729149-67729171 CTGCAGTCCCAGGTAGAGCCTGG - Intronic
1042482706 8:69322320-69322342 CTGGAGACCCAGGGAGCAGCTGG + Intergenic
1042482934 8:69324096-69324118 CTGGAGACCCAGGGGGCAGCTGG + Intergenic
1043871838 8:85441703-85441725 GTTGAGAACCAGGTGGAGGTAGG - Intronic
1044502721 8:92978222-92978244 GAGGAGACCCAGGTAGAGCCTGG - Intronic
1047343965 8:124009533-124009555 CTGGAGACCCAGGGAGAAGATGG + Intronic
1048049321 8:130802584-130802606 CTGAAGAGATAGGTGGAGGCAGG - Intronic
1049031791 8:140043616-140043638 CTGGTGACCCTGCTGTAGGCTGG - Intronic
1049189478 8:141278966-141278988 CTGGGGGCCAAGGTGGGGGCTGG - Intronic
1049220210 8:141425572-141425594 CTGGGGACCCAGGTCTGGGCGGG + Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1051315548 9:15826734-15826756 CTGGAGCCTCAGCTGAAGGCTGG - Intronic
1051480693 9:17556820-17556842 CTGGACACCCTCGTGGAGGCTGG - Intergenic
1051672669 9:19527821-19527843 CTGGACAGCCATGTGGAGGCAGG - Intronic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1054993074 9:71352921-71352943 CAGGAGACCTGTGTGGAGGCAGG - Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1056170375 9:83979807-83979829 CGGGAGACCCAAGGTGAGGCGGG + Intronic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056658931 9:88530843-88530865 CTGGGGGCCCAGGTGGTGGGGGG - Intergenic
1058766416 9:108186826-108186848 GTGGAGATGCAGCTGGAGGCAGG - Intergenic
1058991649 9:110259293-110259315 CTCCAGTCCCATGTGGAGGCTGG - Intergenic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1059464893 9:114462201-114462223 CTGTAGACCCAGCTACAGGCAGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1060831820 9:126722346-126722368 CTGGAGACCAGGTTGGGGGCTGG - Intergenic
1061001547 9:127905565-127905587 TTGGACACCCAGGATGAGGCAGG + Intergenic
1061045068 9:128160429-128160451 CTGGGGATGCCGGTGGAGGCGGG + Exonic
1061082680 9:128381571-128381593 CTGTAATCCCAGGTTGAGGCAGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1061922244 9:133788601-133788623 CTGGTGAGCCAGGTGAGGGCAGG - Intronic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062428985 9:136518560-136518582 CTTGAGGCCCAGGTGGGCGCAGG - Intronic
1062437278 9:136551884-136551906 CTGGTGCCCCAAGTGGAGCCTGG + Intergenic
1062486202 9:136777530-136777552 CTGGAGACCCAGGGTGGAGCTGG + Intergenic
1062486229 9:136777675-136777697 CTGGAAACCCAGGGAGAAGCCGG - Intergenic
1062486247 9:136777782-136777804 CTGGAGACCTGGGGAGAGGCTGG - Intergenic
1062486259 9:136777835-136777857 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
1062666226 9:137674233-137674255 CAGGAGGCCCTGGTGCAGGCGGG - Intronic
1185499397 X:585391-585413 CAGGTGGCCCAGGTGGGGGCCGG - Intergenic
1185503185 X:614339-614361 CAGGGGTCCCAGGTGGGGGCAGG - Intergenic
1185521858 X:746253-746275 CTGGAGACCCACTTGGCAGCAGG + Intergenic
1185873641 X:3684678-3684700 TCGGAGACCCAGGTGTGGGCAGG + Intronic
1186216282 X:7304725-7304747 ATGGAGAGCCACTTGGAGGCAGG - Intronic
1186608048 X:11111684-11111706 GTGGTGACCCGGGTGGAGGAGGG - Intronic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1190172337 X:48121622-48121644 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190177979 X:48167271-48167293 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190180171 X:48185157-48185179 CAGCAGCCCCAGGTGGAGGCAGG - Intergenic
1190183945 X:48218915-48218937 CACCAGCCCCAGGTGGAGGCAGG + Intronic
1190189878 X:48268368-48268390 CACCAGCCCCAGGTGGAGGCAGG + Intronic
1190197102 X:48329057-48329079 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190658623 X:52634868-52634890 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190659693 X:52642988-52643010 CACCAGCCCCAGGTGGAGGCAGG - Intergenic
1190665922 X:52695824-52695846 CACCAGCCCCAGGTGGAGGCAGG - Intronic
1190673496 X:52762586-52762608 CACCAGCCCCAGGTGGAGGCAGG + Intronic
1190677041 X:52791357-52791379 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1192186738 X:68952210-68952232 CTGGAGTTCCAGGTGGACGTGGG + Intergenic
1192625145 X:72719362-72719384 GTGAAGACCCAGGTGGAGATGGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195745800 X:108116733-108116755 CTGGAGAGGAAGGTGGAGCCAGG - Intronic
1195923068 X:110002231-110002253 CTGGAGAACCAGGTCGCGGGAGG + Intergenic
1197472271 X:126878142-126878164 CTTGAGCTCAAGGTGGAGGCTGG + Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1198444589 X:136699747-136699769 CTGGAGAACCATCTTGAGGCGGG + Intronic
1199086621 X:143635582-143635604 CTGGAGAGCCTGGGGGAGGGGGG + Intronic
1199743370 X:150756539-150756561 CTGGCCACCCATGTGGAGACTGG - Intronic
1199964919 X:152811825-152811847 TTGGAGACCAAGGTGTGGGCAGG - Intergenic
1201782608 Y:17740157-17740179 CTGGAGACCTGGCTGGGGGCTGG - Intergenic
1201818945 Y:18165831-18165853 CTGGAGACCTGGCTGGGGGCTGG + Intergenic