ID: 1101625848

View in Genome Browser
Species Human (GRCh38)
Location 12:106440448-106440470
Sequence CAGATTGTGCAGGAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101625848_1101625858 25 Left 1101625848 12:106440448-106440470 CCTTCCAGTTCCTGCACAATCTG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 1101625858 12:106440496-106440518 ACTCCCTGTTTCAACCACACTGG 0: 1
1: 0
2: 1
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101625848 Original CRISPR CAGATTGTGCAGGAACTGGA AGG (reversed) Intronic
900354595 1:2254195-2254217 CTGATTGTGAAGAATCTGGAAGG + Intronic
900581579 1:3412374-3412396 GAAGTTGGGCAGGAACTGGAAGG - Exonic
902539517 1:17143916-17143938 GAAATTGGGCAGGCACTGGAGGG + Intergenic
903361109 1:22777819-22777841 CAGTATGTGCAGGCACTGGGTGG + Intronic
903420686 1:23216620-23216642 CACATAATGCCGGAACTGGAAGG - Intergenic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906100292 1:43255975-43255997 CAGATTGTGCAGGACCGTGAAGG + Intronic
907761316 1:57363685-57363707 AAGATTGTACAGTCACTGGAAGG + Intronic
910064103 1:83132217-83132239 CAGTTTGTGCAAGAAGTGAAGGG + Intergenic
910604291 1:89066847-89066869 CAGATTGTCCTGGAAGTGTAGGG + Intergenic
911117749 1:94264342-94264364 CAGAAGGTGCAGGATTTGGATGG - Intronic
913617411 1:120575661-120575683 CAGATTTTCAAGGACCTGGAAGG - Intergenic
914572863 1:148935259-148935281 CAGATTTTCAAGGACCTGGAAGG + Intronic
915060986 1:153184799-153184821 CTGAATGTGCAAAAACTGGAAGG - Intergenic
915837099 1:159186249-159186271 CAGACTGTACAGGACCTTGAAGG + Intronic
916021750 1:160798698-160798720 CAGAATATGCAGACACTGGAAGG - Intronic
916169842 1:161993691-161993713 CAGGTTGGGCAGGGAATGGAAGG - Intronic
916259287 1:162824759-162824781 CAGAATGTGCATTATCTGGATGG - Intronic
917749287 1:178039737-178039759 CAGATAGAGCATGACCTGGAAGG + Intergenic
921757238 1:218872900-218872922 CAGAGTGTGCAGGATCTTGCAGG + Intergenic
922301205 1:224302551-224302573 CAGATTTTTCAGAAACTGTAGGG - Intronic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922804269 1:228377542-228377564 CTGGTTGTGCAGGTACTGGGTGG - Exonic
923276791 1:232403511-232403533 CAGCATGGGCAGGACCTGGAAGG - Exonic
923317085 1:232791121-232791143 AGAATTGTGAAGGAACTGGAAGG + Intergenic
923808011 1:237281666-237281688 CAGATGGTGCAGGCATTGGTAGG + Intronic
924623163 1:245679899-245679921 CAGGTTGGGCAGGCACAGGAAGG - Intronic
1063168865 10:3487899-3487921 CAGTAGGTGCAGGCACTGGACGG - Intergenic
1063439076 10:6057493-6057515 CATAGAGTGAAGGAACTGGAAGG + Intronic
1066242246 10:33549593-33549615 GAGATTATGCAGGAAGTGGTGGG - Intergenic
1067180884 10:43985207-43985229 CAGATGGTGCAGGTATGGGAGGG + Intergenic
1067233548 10:44427958-44427980 AAGATGGAGCAGGTACTGGAGGG + Intergenic
1069729823 10:70603345-70603367 TAGGTTGAGCAGGAAGTGGATGG - Intergenic
1070195425 10:74151795-74151817 CAGAATGTGCACGAAAAGGAAGG - Intronic
1071031506 10:81189080-81189102 AAGATTGTGCAGGGATTGGGGGG + Intergenic
1071863466 10:89700274-89700296 TTGATTGTGCAGGACCTGGGAGG + Intergenic
1071886684 10:89958973-89958995 CAGATTTTCAAGGAACTGAAAGG - Intergenic
1072807483 10:98433658-98433680 TATATTGAGCTGGAACTGGAGGG - Intronic
1073321041 10:102616464-102616486 CAGAATGAACAGGACCTGGAGGG + Intronic
1073324930 10:102637149-102637171 CAGACTGTGCAGGACCTCGGAGG + Intergenic
1075212501 10:120502992-120503014 CAGATTGGGGAGGAAATGGATGG - Intronic
1075946439 10:126437308-126437330 CAGCTGGTTCAGGGACTGGAAGG - Intronic
1076757134 10:132578541-132578563 GAGAGTGTGCGGGGACTGGAGGG + Intronic
1077235479 11:1480161-1480183 CAGAAGGTGCAGGAGCTGGTGGG - Intronic
1077258062 11:1598018-1598040 CAGCTGGTGCAGGAACAGGCTGG + Exonic
1077274462 11:1697372-1697394 CAGCTGGTGCAGGAACAGGCTGG - Exonic
1078650237 11:13184539-13184561 CAGATTGTCAGAGAACTGGAAGG + Intergenic
1079539901 11:21560591-21560613 GAGATTGAGAAGGAACTGCAGGG + Intronic
1080775019 11:35377991-35378013 AACATTGTGCAGGAACTTGGAGG + Intronic
1081805865 11:45890181-45890203 CAGGATGTGCAGGAACTTGTAGG + Intronic
1083968257 11:66056462-66056484 CAGATTGTGCTGGATCTTGAGGG + Intronic
1084020930 11:66417587-66417609 TAGATGGTGCAGGAACTCAACGG + Intergenic
1084892538 11:72243740-72243762 GGGATTCTGCAGGAATTGGAGGG + Intronic
1085219884 11:74864930-74864952 CAGACTGTGCAGGGACTTGCTGG + Intronic
1085816037 11:79738623-79738645 CAGAGTGTTCGGGAGCTGGAAGG + Intergenic
1085949134 11:81308234-81308256 CATATTGTGCATGAACTCCAAGG - Intergenic
1086086517 11:82960874-82960896 CAGACTGTGAAGGAGCTGTACGG - Intronic
1089294671 11:117460469-117460491 CAGAAAGTGCAGGAGCTGGGTGG + Intronic
1089372410 11:117970840-117970862 CACACTGAGCAGGAAGTGGAGGG + Intergenic
1089973382 11:122712264-122712286 CAGATTGTACAGAAACCAGATGG + Intronic
1090647515 11:128777681-128777703 CTGAGTGTGCAGGAGCGGGAGGG - Intronic
1091203308 11:133799574-133799596 CAGATTTTGAAGGATCTTGAAGG + Intergenic
1091274342 11:134340364-134340386 CAGAATGAGGAAGAACTGGATGG - Intronic
1091634500 12:2186917-2186939 CAGATGGTGCAGCACCAGGAAGG - Intronic
1092289281 12:7149546-7149568 GAGATTGTGCACAACCTGGATGG + Exonic
1093970054 12:25368313-25368335 CCTATTCTGCAGAAACTGGAAGG + Intergenic
1095750525 12:45705569-45705591 GAGATAGTGCAGAAGCTGGAGGG - Intergenic
1098252521 12:68584961-68584983 CAGGTAATGCAGGAACTGGCAGG + Intergenic
1100386018 12:94105197-94105219 CAGATTGTGGCAGAAGTGGAGGG + Intergenic
1101403368 12:104407365-104407387 CATATCCTGCAGGAAATGGAGGG - Intergenic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1101937497 12:109070021-109070043 CAGATTGTGCAGGGACTAGGAGG + Intronic
1104662131 12:130618787-130618809 GAGACTGTGCACGAACGGGATGG + Intronic
1107111219 13:36700104-36700126 CAGACTATGTAGGAACTGGTAGG + Intergenic
1107975778 13:45687605-45687627 CAGCTACAGCAGGAACTGGAGGG - Intergenic
1112002909 13:95228380-95228402 CAGACTGAGTAGGAAGTGGAAGG - Intronic
1112872453 13:103991857-103991879 CAGAGTGTGGAAGACCTGGAGGG - Intergenic
1114221876 14:20704067-20704089 CAGATATTGGAGGAACAGGAGGG - Intergenic
1114616229 14:24069757-24069779 CAGATTGTGGAGGCAGTGAATGG - Intergenic
1117344833 14:54821831-54821853 GATTTTGTGCAGGATCTGGATGG - Intergenic
1118376961 14:65185790-65185812 CAGATCGAACAGGTACTGGATGG - Intergenic
1119666025 14:76485743-76485765 CTGTCTGTGCAGGAACTAGATGG - Intronic
1119756507 14:77123813-77123835 CAGATTGTGCAGGAGCCTGGAGG - Intronic
1120743389 14:88132179-88132201 CTGATGGGGCAGGAACTGAAGGG - Intergenic
1122098822 14:99391236-99391258 GAGCTTGTGGAGGAACAGGATGG - Intergenic
1122339845 14:101020727-101020749 CAGATGGAGCATGGACTGGATGG - Intergenic
1122354554 14:101115064-101115086 CAGATTGAGCAGGAAAGGGAAGG - Intergenic
1123995278 15:25713798-25713820 CAGTGTGTGCAGGAGCTCGAAGG + Exonic
1125520841 15:40347087-40347109 CAGACTGGGGAGGCACTGGAAGG + Intergenic
1126237650 15:46404760-46404782 CAGAGTGTGCAGGCTCTGAATGG - Intergenic
1126363481 15:47870406-47870428 AAGATTTTGCAGGGATTGGATGG - Intergenic
1129236408 15:74226188-74226210 CCGATTGTGGAGGAAGTGGTGGG + Intergenic
1130705333 15:86227838-86227860 CAGATTCTACAGGATCTTGAGGG + Intronic
1130898942 15:88192627-88192649 CAGCTTGTGCAGGACCTTGAGGG - Intronic
1131853624 15:96568817-96568839 CAGATTGTGAATCGACTGGAAGG + Intergenic
1133024480 16:2982006-2982028 CAGAGGGTGCAGGAACTGAATGG - Intergenic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134511879 16:14855035-14855057 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134699522 16:16253534-16253556 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134972307 16:18541137-18541159 CAGATTGTGCAGGGCTTGGTGGG - Intronic
1135250564 16:20898136-20898158 CAGCTGGTGCAGAAACTGGCTGG - Intronic
1138764996 16:59591439-59591461 CAGATTCTTCAGGAACTAGTGGG + Intergenic
1138874389 16:60931529-60931551 GAGATTGTGTAGGACCTTGAAGG + Intergenic
1139546314 16:67651449-67651471 CAGCTTGGGCAGAAGCTGGAGGG + Exonic
1139837891 16:69854382-69854404 CGGATTCTGTTGGAACTGGATGG + Intronic
1143075744 17:4341623-4341645 GAAATGGTGCAGTAACTGGAGGG - Intronic
1143692498 17:8581146-8581168 CAGATGGAGCAGGAAGGGGAGGG + Intronic
1144706483 17:17371709-17371731 CAGCTTGTGCAGGAGCCTGAAGG - Intergenic
1145207193 17:20990833-20990855 AAGGTTGTGCAGGGACTGGGAGG + Intergenic
1146260305 17:31416378-31416400 CTCAGGGTGCAGGAACTGGAAGG + Intronic
1146410429 17:32578923-32578945 CAGATTGTCAAGGAACTTGAAGG - Intronic
1147460102 17:40562908-40562930 CATAAGGTGCAGGAAGTGGAGGG - Intronic
1148618398 17:49016660-49016682 CAGAGTGTGAGGGGACTGGAAGG - Intronic
1149598887 17:57880671-57880693 CGGAGTGTGCCAGAACTGGAGGG - Intronic
1149622103 17:58053438-58053460 CAAATGGTGAAGCAACTGGAGGG - Intergenic
1150266511 17:63835487-63835509 GCGATAGTGCAGGAACTGCAGGG - Exonic
1151084041 17:71360643-71360665 CAGATTGAGAAAGAAATGGAAGG - Intergenic
1152100812 17:78300890-78300912 CAGTTTGTGGGGGAACAGGAAGG - Intergenic
1152920509 17:83064275-83064297 CAGATGGTGCAGGGGCTGCAGGG - Intergenic
1155386077 18:25278980-25279002 CAAATTGTGGAGAAACTGGTGGG + Intronic
1155407398 18:25503818-25503840 CAACTTGTGCAAGATCTGGAAGG - Intergenic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156263207 18:35463539-35463561 CAGCTTGAGCAGGAAAAGGAGGG - Intronic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1158670213 18:59467798-59467820 CAGCTTGTGCAGGGAGTGGCTGG - Intronic
1160165075 18:76503957-76503979 CAGCGTGTGCAGGACCTGGACGG + Intergenic
1161238829 19:3210753-3210775 CAGGTTGTGCAGGGCCTGGTGGG + Intergenic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1162096327 19:8312001-8312023 CAGACTGGGCAAGAACTGCATGG + Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1162923316 19:13916830-13916852 CAGATTTTGCAGACACTGGGTGG + Intronic
1164534449 19:29074937-29074959 GAGAGTGCGAAGGAACTGGAAGG + Intergenic
1165289932 19:34874821-34874843 CAGAGTCTGCAGGCCCTGGAAGG + Intergenic
1167784761 19:51627798-51627820 CAGCTGGAGCAGGAACTGCATGG - Intronic
1167876063 19:52413650-52413672 CAGATGTTGCTGCAACTGGAGGG + Intronic
1168076646 19:53983887-53983909 CAGATTGTGCAGGGGCTCGTAGG + Exonic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
926921915 2:17947286-17947308 CAGACTATGCAGGCACTGGTGGG + Intronic
927157717 2:20231211-20231233 CAGGATGTTCAGGAACTGGAAGG + Intergenic
928443937 2:31316412-31316434 CAGAGTGTGCAGACACTTGAAGG - Intergenic
930408398 2:50992056-50992078 CAGATTGGACAGAAACTGGGTGG - Intronic
930686545 2:54314070-54314092 CAGATTGTGCATGGCCTGGTAGG - Intergenic
930870545 2:56166673-56166695 CAGATTGTGCAGCTATAGGATGG + Intergenic
931847739 2:66222184-66222206 AAGAAGGTGCAGGAACTGGGGGG - Intergenic
932050571 2:68393921-68393943 CAGGGTGTGGAGGATCTGGAAGG + Intronic
935294800 2:101639527-101639549 CAGAGTTTTCAGGAATTGGAAGG - Intergenic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
937457507 2:122055203-122055225 CACATTGGGCAGCAACTAGATGG - Intergenic
939203014 2:139062855-139062877 CAGATTGGGCAAGGTCTGGAAGG + Intergenic
942299237 2:174546591-174546613 CAATTTGTGCAGGACCTGGAGGG - Intergenic
943626941 2:190211653-190211675 GAGATTATGCAGGGACAGGAGGG - Intronic
948014427 2:234676503-234676525 CAGATTTAGAAGCAACTGGATGG - Intergenic
1169780271 20:9301913-9301935 CACATTGAGCAGTTACTGGAAGG - Intronic
1169874031 20:10276949-10276971 AAGATTCTGCAGGAACCTGAAGG - Intronic
1170292853 20:14789770-14789792 CAGAATTTGCAGGACCTGGCCGG - Intronic
1171451629 20:25239861-25239883 CAGACTGAGCAGGAAGTGGTGGG + Intergenic
1174562158 20:51439137-51439159 CAGGTTGTGCAGGGCCTTGAGGG - Intronic
1174671867 20:52315716-52315738 CAGTCTTTGCAAGAACTGGAAGG + Intergenic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1175074775 20:56363134-56363156 CAGAATGTCCAGGCTCTGGAGGG - Intronic
1175314033 20:58033408-58033430 CAGATTGAGGAGAAACTGCAAGG + Intergenic
1178350177 21:31867217-31867239 CAGATTGTGCTGGGCCTGGCAGG + Intergenic
1180742915 22:18066203-18066225 CTGCATGTCCAGGAACTGGATGG + Intergenic
1181634577 22:24168685-24168707 CATAGTGGGCAGGAACTTGACGG + Intronic
1182001937 22:26926830-26926852 CAGATTGTGCAGGATCTTGCAGG + Intergenic
1183259268 22:36783808-36783830 CAGAGTGTGCAGGACATGGAGGG - Intergenic
1183382424 22:37496824-37496846 CTGATTGGGCAGGGACTGGGAGG - Intronic
950807859 3:15623262-15623284 TAGATTGTGTAGTAAATGGATGG - Intronic
952628923 3:35441226-35441248 CAGATTGTGAAATATCTGGATGG - Intergenic
952815451 3:37443295-37443317 GAAATTTTGCAGGAAATGGAAGG - Intergenic
953670314 3:44956887-44956909 CAGATTGTGCAGGGCCTGGTAGG - Intronic
954169315 3:48787941-48787963 CAGAATGTGCAGAGACAGGAAGG - Intronic
954290036 3:49644803-49644825 CAGAATGTGCACGAATGGGAGGG + Intronic
956741864 3:72281652-72281674 CAGATGGGGCAGGACCTGGTGGG - Intergenic
959783311 3:110263006-110263028 GAGAGTGTTCAGGAAATGGATGG + Intergenic
960357622 3:116673058-116673080 AATATTGTGCAGTGACTGGAAGG - Intronic
961697012 3:128712412-128712434 CAGATAGTGCAGGGCCTTGAAGG + Intergenic
965547097 3:169927153-169927175 GAGATGGTCGAGGAACTGGAGGG - Exonic
966269840 3:178091194-178091216 CAGATTTTCCAGTACCTGGAGGG - Intergenic
967889838 3:194357156-194357178 CTTTTTGTGCAGGAACTGGAAGG + Intronic
968817807 4:2830794-2830816 CAAAGGGTCCAGGAACTGGAGGG + Intronic
971903751 4:32698280-32698302 CAGATGGTGCAGCAATAGGAGGG + Intergenic
972300942 4:37785090-37785112 GAGAAGGTGCAGGAACTGGCTGG - Intergenic
973599796 4:52530961-52530983 CAGTTTGGGAAGGAACTTGAGGG - Intergenic
974125075 4:57686102-57686124 CAGATAGTGCAGGGCCTTGAAGG - Intergenic
974350136 4:60733855-60733877 CTGAATGGGCAAGAACTGGAAGG - Intergenic
974406284 4:61475267-61475289 CATATTTTGTTGGAACTGGAAGG + Intronic
975281650 4:72568996-72569018 CAGAGTGTGCAGGAGCGAGAAGG + Intergenic
981406577 4:144377123-144377145 CTAATTCTGCAGGCACTGGAAGG - Intergenic
981606055 4:146541855-146541877 CTGAATGGGCAAGAACTGGAAGG - Intergenic
981624471 4:146740035-146740057 GAGATGGTGGAGGCACTGGATGG + Intronic
981870080 4:149475306-149475328 CAGATTTTGAAGCAATTGGAAGG + Intergenic
986069869 5:4271165-4271187 CAGTTTGTGCAGGATATGAATGG + Intergenic
986085660 5:4442576-4442598 TAGATTCAGCAGAAACTGGATGG + Intergenic
987748133 5:22004415-22004437 CAGAAAGTGTAGGAACTTGAAGG - Intronic
989732655 5:44665990-44666012 CAAATTGTGTAAGAAATGGAAGG - Intergenic
990108647 5:52295189-52295211 CAAATCGTGCAGAAACTGGAAGG + Intergenic
991509576 5:67361765-67361787 CAGATTGGAGAGGGACTGGATGG + Intergenic
991768307 5:70014201-70014223 CAGAAAGTGTAGGAACTTGAAGG - Intergenic
991847545 5:70889283-70889305 CAGAAAGTGTAGGAACTTGAAGG - Intergenic
993296971 5:86153200-86153222 CAAACTAGGCAGGAACTGGAGGG + Intergenic
995043382 5:107615812-107615834 CAGCTTTTGCTGTAACTGGAGGG - Intronic
995663402 5:114511856-114511878 CAAATGGTTCAGGAAATGGAGGG + Intergenic
996170960 5:120290774-120290796 CAAAGTGAGCAGGAAATGGAGGG - Intergenic
997262760 5:132476915-132476937 CTGATTGTGGAGGCAGTGGAGGG - Intergenic
999798175 5:155007504-155007526 CAGCTTGTGCATAAACTGGAGGG + Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1001734268 5:173986112-173986134 AAGGTTTTTCAGGAACTGGAAGG - Intronic
1003159152 6:3620440-3620462 GAGTTGGGGCAGGAACTGGATGG - Intergenic
1003231463 6:4257558-4257580 AAGATTGTGCTAGAACTGTAAGG - Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005962122 6:30701566-30701588 CAGCTTCTGCAGGAAATAGATGG + Intronic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008875418 6:56320495-56320517 CAGATTGTGTAGGACCTTGGGGG - Intronic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1013489247 6:110629274-110629296 CAGATGGTGCAGGAGCCAGATGG - Intronic
1013548437 6:111183121-111183143 CAGATTGTGAAGGACCTTGTAGG - Intronic
1015051019 6:128840141-128840163 GATATTTTGGAGGAACTGGAAGG + Intergenic
1015138875 6:129907492-129907514 GAGATTCAGCAGGAGCTGGAGGG + Intergenic
1015214163 6:130731026-130731048 CAGTTTGTGCCAGAAATGGAAGG - Intergenic
1015214473 6:130734038-130734060 CAGTTTGTGCCAGAAATGGAAGG - Intergenic
1016580436 6:145623570-145623592 CAGATTGTACAGGACCTCAAAGG + Intronic
1017947973 6:159111304-159111326 CAGACTGGGCAGGCACTGGCAGG - Intergenic
1018143142 6:160859931-160859953 GAACTTGTGCAGGAACAGGAAGG + Intergenic
1018772718 6:166986184-166986206 TAGATAGTGAAGGAACTGGGTGG - Intergenic
1018815960 6:167331037-167331059 CAACTTGTGCAGGAACAGGAAGG - Intronic
1020427583 7:8086476-8086498 CAGCTCCTGCAGGAACTGCAGGG + Exonic
1022226305 7:28367374-28367396 GAGATTGTGGAGGAACAGGTTGG - Intronic
1023088380 7:36594994-36595016 CAAATTGTGCAGGAGTTGCAGGG - Intronic
1023644685 7:42297859-42297881 CAGAGTGTGGAGGAAGTGGGTGG - Intergenic
1024600254 7:50974181-50974203 CAGGGAGGGCAGGAACTGGAGGG + Intergenic
1029111524 7:98215097-98215119 CTGCTTGTGCAGGGACTTGAGGG - Exonic
1029281301 7:99437658-99437680 CAGTTTGTGCAGCAACTACAAGG - Intronic
1029483603 7:100826826-100826848 CCGATAGTGCTGGAACGGGAGGG - Intronic
1029694649 7:102204714-102204736 CAGGTTGTGGAGGAAGGGGACGG - Intronic
1031406906 7:121396492-121396514 CAGATTGTGCAGCGCCTGGCCGG - Intergenic
1034207309 7:149329223-149329245 AAAATTGAACAGGAACTGGAGGG - Intergenic
1034455057 7:151165602-151165624 CAGATAGAGCAGCAACTGGAAGG - Intronic
1035096084 7:156356905-156356927 CAGAGTGTGCTGCAGCTGGATGG + Intergenic
1035311978 7:157975193-157975215 CAGTGTTGGCAGGAACTGGAGGG - Intronic
1037827609 8:22168560-22168582 CAGAGTCTGCAGGAGCGGGAGGG + Intronic
1038075237 8:24065858-24065880 CAGATTGTTCTGCAATTGGATGG + Intergenic
1039703323 8:39983015-39983037 CTGATTTTGCAGGAGCTTGAAGG - Intronic
1041053059 8:53956231-53956253 CAGATTGTGCCAGAAAGGGAGGG + Intronic
1044879261 8:96705983-96706005 CAGAATGTGGAGTAACTGGGAGG - Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047848359 8:128828063-128828085 CAGATTGTGGGGAAAATGGATGG - Intergenic
1047933417 8:129752068-129752090 CAGATTGTCCTGGAAGGGGAGGG + Intronic
1048199741 8:132362440-132362462 CAGTTTCTGCTGGAACTGGAAGG - Intronic
1048692519 8:136983632-136983654 CAGTTTGTGCAGACACAGGAAGG - Intergenic
1048982424 8:139709941-139709963 CACACTGTGCAGGAACAGGATGG + Intergenic
1051144921 9:14016729-14016751 CAGAAAGGGCAGGAGCTGGAAGG + Intergenic
1052996491 9:34554027-34554049 CAGGCTGAGCAGGAACTGGAGGG - Intronic
1053656059 9:40219236-40219258 CAGATTGTGCAAGCCCTGGGAGG + Intergenic
1053906405 9:42848438-42848460 CAGATTGTGCAAGCCCTGGGAGG + Intergenic
1054368165 9:64365460-64365482 CAGATTGTGCAAGCCCTGGGAGG + Intergenic
1054528555 9:66157059-66157081 CAGATTGTGCAAGCCCTGGGAGG - Intergenic
1054675785 9:67855203-67855225 CAGATTGTGCAAGCCCTGGGAGG + Intergenic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1059514441 9:114879949-114879971 GAGATGGTACAGAAACTGGAGGG + Intergenic
1059666166 9:116448301-116448323 CACATTGTGCTGGAAATGGCAGG - Intronic
1059847223 9:118293773-118293795 CACAATTTGCAGGAACTGCAGGG - Intergenic
1060185304 9:121560466-121560488 CAGATTTTGCAGGGCCTGGCAGG + Intergenic
1060869822 9:127030594-127030616 AAGAGTGAGCAGGAGCTGGAGGG + Intronic
1185883960 X:3765228-3765250 CAGATTTTGCAGAAATTGCAAGG - Intergenic
1185985264 X:4825674-4825696 TAGATTGTGTAGGAACTTAAAGG - Intergenic
1189563517 X:42215465-42215487 CAGATTCTTCAGGAACTTGGAGG - Intergenic
1190272988 X:48881375-48881397 CAGATTTTGCAGTCACTGAAAGG + Intergenic
1192267466 X:69548689-69548711 CAGCTAGTGCAGGAGGTGGAGGG + Intergenic
1192917040 X:75663710-75663732 CAGAGTGGGCAAAAACTGGAAGG - Intergenic
1197712776 X:129683838-129683860 CAGATTGAGCAGGACCTTGGAGG + Intergenic
1200781402 Y:7219708-7219730 CAGATTTTGCAGAAATTGCAAGG + Intergenic