ID: 1101636701

View in Genome Browser
Species Human (GRCh38)
Location 12:106549486-106549508
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 11, 1: 5, 2: 18, 3: 21, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101636697_1101636701 13 Left 1101636697 12:106549450-106549472 CCTGGATATCCTTGTTAACTTTC 0: 1971
1: 2961
2: 4902
3: 2274
4: 1449
Right 1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG 0: 11
1: 5
2: 18
3: 21
4: 156
1101636698_1101636701 4 Left 1101636698 12:106549459-106549481 CCTTGTTAACTTTCTGTCTCTTT 0: 40
1: 2510
2: 5245
3: 2718
4: 2215
Right 1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG 0: 11
1: 5
2: 18
3: 21
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905862417 1:41360553-41360575 TGTCTAAAGTTCACAGTGTTTGG - Intergenic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
907565916 1:55433273-55433295 TGCCTAATATTGACAGAGGGGGG - Intergenic
907587981 1:55638536-55638558 TGTCTGATGGTGGCTGTGGGAGG + Intergenic
912139788 1:106709884-106709906 CGTCCAGTGTTGTCAGTGGGAGG + Intergenic
912152101 1:106872350-106872372 TGTCTAATATTGTCAGTGGGGGG - Intergenic
915056367 1:153134423-153134445 TTTCTAGTGGTGGCAGTGGGGGG - Intergenic
918008916 1:180568149-180568171 TCTCTGATGTTGTCAATGGGAGG - Intergenic
924878468 1:248131213-248131235 TGTTTCATATTGACAGTTGGGGG - Intergenic
1065254147 10:23848291-23848313 TGTCTAATATTGACAGTGGGGGG + Intronic
1066020716 10:31297935-31297957 AGTCTAATGTTGATAGTTCGGGG + Intergenic
1068357240 10:55924481-55924503 TGTTCAATGTTGACAGTGATGGG - Intergenic
1068711240 10:60136429-60136451 TGTCTAATGCAGAGAGTGGCCGG - Intronic
1070810757 10:79296621-79296643 TGCCCCATGTTGACCGTGGGGGG - Exonic
1071035226 10:81236883-81236905 TGTCTAACATTATCAGTGGGAGG + Intergenic
1073784722 10:106876591-106876613 TGTCAAATCTACACAGTGGGTGG + Intronic
1076419281 10:130317950-130317972 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1077944923 11:6886729-6886751 TGTCAAAAGTGGCCAGTGGGAGG + Intergenic
1080214947 11:29829617-29829639 TGTCTAATATTGACAGTGAGGGG - Intergenic
1082618874 11:55396843-55396865 TGTCTAATGTTGACAGTAGTGGG + Intergenic
1083385261 11:62304229-62304251 TGTCTAATATTAACAGTGAGGGG + Intergenic
1085478838 11:76805427-76805449 TGTCGAATGTTACCGGTGGGTGG - Intergenic
1085827392 11:79862463-79862485 TGTTAAATGCTGTCAGTGGGGGG - Intergenic
1090578575 11:128135347-128135369 TGTTTTATGTTGAGAGTGTGTGG + Intergenic
1091200323 11:133774962-133774984 TGTCTAATGTTTAGATTGAGAGG + Intergenic
1092398354 12:8148573-8148595 TGTCTAATATTGACAGTGGAGGG - Intronic
1092719171 12:11423881-11423903 TGTCTAATGTGGACACAGTGGGG + Intronic
1093135196 12:15440926-15440948 TGTCTACTGCTGTCAGTTGGGGG - Intronic
1093497746 12:19777218-19777240 TGTCTGATATTGTCAGTCGGGGG + Intergenic
1094862089 12:34478859-34478881 TGTCTAATGTTGACAGACAGTGG - Intergenic
1097418978 12:59350272-59350294 TGTCTGATATTGACAGTGGGGGG + Intergenic
1097890829 12:64775692-64775714 TGTCTAATATTGTCAGCAGGTGG - Intergenic
1099767416 12:87005835-87005857 TATCTAATGCTTTCAGTGGGGGG + Intergenic
1099781902 12:87205911-87205933 TGTCCAATGTTGAAGGTAGGAGG - Intergenic
1100907556 12:99319252-99319274 TGTCTAATGTTGACAGTGGGGGG + Intronic
1101068813 12:101051260-101051282 TTTCTGAGGTTGAAAGTGGGTGG + Intronic
1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG + Intronic
1102632441 12:114293117-114293139 TGTCTAATTCTCACAGTGGTTGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104743207 12:131193881-131193903 AGTCTCATGTTGAAAGGGGGAGG + Intergenic
1106006970 13:25779777-25779799 TCTTTGATGTTGACAATGGGAGG + Intronic
1107164701 13:37270816-37270838 TGTCAAATGTCCCCAGTGGGTGG - Intergenic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1109188174 13:59294366-59294388 TATATTATGTTGACACTGGGTGG - Intergenic
1111177777 13:84619212-84619234 AATGAAATGTTGACAGTGGGAGG - Intergenic
1112056382 13:95692350-95692372 TGTCTTGTGTTGTCAGTGGGGGG + Intronic
1112286160 13:98106185-98106207 AGTCTAATGTTGACAGATGCAGG - Intergenic
1112301310 13:98233172-98233194 TGTCTAATGTTAAGAGGGAGTGG + Intronic
1114148362 14:20005643-20005665 TTACTAATTTTGACAGTGTGGGG + Intergenic
1115420163 14:33184764-33184786 GTTCTGATGTGGACAGTGGGTGG + Intronic
1115679693 14:35722693-35722715 TGTCTAATGTTAAAAGGGAGTGG - Intronic
1115920522 14:38367394-38367416 TTTCTTATTTTGTCAGTGGGAGG - Intergenic
1115964549 14:38872962-38872984 TGTTTGATGTTGACACTTGGAGG - Intergenic
1116800714 14:49440471-49440493 TGTCTAATGTTGATGCTGGCAGG - Intergenic
1117779628 14:59219122-59219144 TTTCTAATGTTGGCATTTGGTGG + Intronic
1118040014 14:61906211-61906233 TGTCTACTGGTGAATGTGGGAGG + Intergenic
1119681469 14:76595463-76595485 TGTCTAACGTTGACTGTATGTGG + Intergenic
1127701010 15:61501042-61501064 TGTATAACTTTGTCAGTGGGTGG + Intergenic
1128291727 15:66483256-66483278 TGAGTGATGTTGACAGTGGCTGG - Intronic
1129564397 15:76606595-76606617 TGTCTAATGTTGACAGTGGGGGG + Intronic
1130047512 15:80457203-80457225 TGTCTTATGTTTACACTGAGAGG + Intronic
1131214811 15:90528715-90528737 TGTTTAATCTTGATAGTGGGGGG + Intergenic
1133366787 16:5216533-5216555 TGTCTTCTTTTGCCAGTGGGAGG + Intergenic
1134674133 16:16077556-16077578 TGTCTCACGTGGACAGTGGCAGG + Intronic
1135782609 16:25317843-25317865 TGTCTGAAGTTGAGAGTTGGGGG + Intergenic
1137867294 16:51913590-51913612 TTTCTAATTTTTCCAGTGGGAGG + Intergenic
1138407669 16:56810809-56810831 TTTCTCTTGTTGATAGTGGGTGG - Intronic
1138973467 16:62174277-62174299 TGTTTAATCTGGACACTGGGTGG - Intergenic
1203143184 16_KI270728v1_random:1782328-1782350 TGTCTATTGTAGAGTGTGGGTGG + Intergenic
1145774584 17:27519115-27519137 TGGGTAATGGTGACAGTGGGAGG + Intronic
1147902256 17:43796068-43796090 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1148429915 17:47634422-47634444 TTTCTCATGTGGCCAGTGGGTGG + Intergenic
1150850985 17:68703566-68703588 TGTCTAATTTTGACTGAGGCAGG + Intergenic
1151917637 17:77130201-77130223 TGTCTAAAGGTGCCAGTGTGGGG + Intronic
1153986658 18:10357015-10357037 TGGTTACTGTTGACAGTAGGTGG - Intergenic
1156427074 18:37025285-37025307 TGTCTAATGTTGACAGTGGGGGG - Intronic
928802374 2:35110431-35110453 TGTCTAATGTTGACAGTGGGGGG + Intergenic
936149426 2:110006267-110006289 TGTCTAATACTGTCAGTGGAGGG + Intergenic
936195253 2:110365103-110365125 TGTCTAATACTGTCAGTGGAGGG - Intergenic
939211617 2:139182552-139182574 TATCAACTGTTGATAGTGGGTGG + Intergenic
941396666 2:164982150-164982172 TCTCAAATGTTCACAGTGGAAGG - Intergenic
941891546 2:170587390-170587412 TGGCTAATGTTGCCAGTAAGAGG + Intronic
943251778 2:185531205-185531227 TGACTAAAGTTGACAGAGGTAGG - Intergenic
943837082 2:192527038-192527060 TGTCTAATATTGACAGTGAGGGG - Intergenic
947456075 2:230255177-230255199 AGTCTAATGTGGAAAGGGGGAGG + Intronic
948066295 2:235083288-235083310 TCTGCAATGTTGACTGTGGGAGG - Intergenic
1171108118 20:22455487-22455509 TGTCTAATGTTGACTTTTTGAGG + Intergenic
1171272538 20:23827967-23827989 TGTCTCATGGTAACTGTGGGTGG + Intergenic
1171311978 20:24151941-24151963 TGTGTAATGGTGAGAGTGAGGGG - Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1172350414 20:34234990-34235012 TGGCTAATGTTGCCAGTAAGAGG + Intronic
1173776981 20:45716889-45716911 TGTCTAATATTGTCAGTGGGGGG - Intergenic
1175874428 20:62222645-62222667 GGTCTGATGATGACAGTGGCTGG + Intergenic
1182501926 22:30754250-30754272 TGTTTATTGTTGACATTGGAAGG + Intronic
1183069124 22:35384053-35384075 TGTCTCATGTTGGAAGTAGGGGG - Intronic
1184617951 22:45650777-45650799 TGTTTGATGGTGACAGTGGGTGG + Intergenic
949846363 3:8374448-8374470 TGTCTAATATTGACAGTGGGGGG - Intergenic
951137496 3:19120505-19120527 TGTCTAATATTGATGGTAGGGGG - Intergenic
951949277 3:28181469-28181491 GATCTAATGTTGACAGTGGGTGG + Intergenic
957408919 3:79811352-79811374 TGTCTAATGATAACAGAGGCTGG + Intergenic
958789683 3:98637027-98637049 TGTCTAAGGCTGAGAGTAGGGGG - Intergenic
960432797 3:117590359-117590381 TGCAAAATGTTAACAGTGGGAGG - Intergenic
962116501 3:132514849-132514871 TGTCAAAAGTTGAAAGTTGGGGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
964842885 3:161013603-161013625 TGTCTAATGTTGACAGTGGGGGG + Intronic
964846033 3:161045184-161045206 TGTCTAATGTTGACAGTGGGGGG - Intronic
965029500 3:163346514-163346536 TGTAGGATGTTGACAATGGGGGG + Intergenic
967404615 3:189101463-189101485 GGTCCATGGTTGACAGTGGGGGG - Intronic
967732887 3:192922378-192922400 TGTGGAATGTTGACAGTAGAAGG + Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969477505 4:7429894-7429916 TGTCTCACGGTGACTGTGGGAGG + Intronic
970215086 4:13750555-13750577 AGGCTAATGTTGAAAGTGTGGGG + Intergenic
972106309 4:35493576-35493598 TGACTAATGTTGTCAATAGGTGG - Intergenic
972196417 4:36658589-36658611 TGCCTAATATTGACAGTTGAGGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972755823 4:42044628-42044650 TGTCTAATATTGACAATGAGGGG - Intronic
973341989 4:49014811-49014833 TGAGTAATTTTGATAGTGGGGGG - Intronic
974302323 4:60083843-60083865 TGTCTAGTATTAACAATGGGGGG - Intergenic
974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG + Intergenic
975027325 4:69567169-69567191 CCTCTAATGTTAACAGTTGGTGG - Intergenic
975470276 4:74758147-74758169 GGTCTAATGCAGGCAGTGGGAGG + Intronic
975726165 4:77293786-77293808 CCTCTAATGTGGACAGTGAGAGG + Intronic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
978692884 4:111537195-111537217 TGTCTAAGGTGAACATTGGGAGG - Intergenic
978821720 4:112974338-112974360 TGTCTAATGTAAAGAGTGAGAGG + Intronic
979317069 4:119277679-119277701 TGTCTAATGTTGACAGTGGGGGG + Intronic
979967341 4:127090749-127090771 TGTCTAATGTTGTCAGTGAAGGG - Intergenic
980626634 4:135381647-135381669 TGGCTCATGTTGATAGTGGCAGG + Intergenic
981199918 4:141968258-141968280 TGTCTAAATTTGACAGTGGGGGG - Intergenic
985656364 5:1133542-1133564 TGTCTGGGGTTGACTGTGGGTGG + Intergenic
987015007 5:13809083-13809105 TGCCAAATGTTGACAATGTGAGG - Exonic
987883383 5:23779612-23779634 TGTTAAATGTTGAAAGTGGTTGG + Intergenic
987923631 5:24314121-24314143 TGTCTAATACTGACAGTGACAGG + Intergenic
988627763 5:32896452-32896474 TGTCTAATATTGACAGTGAGGGG + Intergenic
989267027 5:39486670-39486692 TGTTTTAGGTTGAGAGTGGGTGG - Intergenic
989305676 5:39952583-39952605 TTTCTAATATTGACAGTGGGTGG - Intergenic
990530825 5:56671781-56671803 TCTCTAAACTTGACAGTGAGAGG - Intergenic
990701860 5:58482777-58482799 TGTATAGTGGTGACAGAGGGGGG + Intergenic
992288577 5:75261420-75261442 TGTAAAAGGTTGACAGTTGGAGG - Intergenic
994345623 5:98682346-98682368 TATCTAATATTGACAGTCGGGGG - Intergenic
998384980 5:141752369-141752391 TGTCTAATGGTGGCTGGGGGTGG - Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1003225518 6:4202093-4202115 TGTTTAATGTTGACAGTGGGGGG + Intergenic
1007118705 6:39362721-39362743 TGACAGATGTTGGCAGTGGGAGG - Intronic
1008535304 6:52502792-52502814 TGTCTGATTTTTACAATGGGAGG - Exonic
1008696441 6:54043841-54043863 TGTGTCATGGTGACAGTGTGTGG + Intronic
1009591066 6:65671846-65671868 TGTCTAATGTTCAGATTTGGAGG + Intronic
1009591660 6:65680318-65680340 TATGTAATGTTGAAAGTGGTTGG - Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1009832923 6:68962064-68962086 AGTTTAATGGTGACAGTAGGTGG + Intronic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011199604 6:84821148-84821170 TGTCTCATATTGACAGTGGAAGG + Intergenic
1011389588 6:86837414-86837436 TGTCTACTACTGACAGTGTGTGG + Intergenic
1012075270 6:94674779-94674801 TGTCTAATATTGACAGTGGGGGG - Intergenic
1013025303 6:106265415-106265437 TGTGTAATATTGACAGTGGGGGG - Intronic
1013756330 6:113465991-113466013 TCTCTGATCTTGACAGTGAGGGG + Intergenic
1015622557 6:135146870-135146892 TGTTTAATGCTGAGAATGGGAGG + Intergenic
1018925137 6:168200657-168200679 AGTCTAAGGCAGACAGTGGGAGG + Intergenic
1020426158 7:8068674-8068696 TAACTAATGTGGTCAGTGGGAGG + Intronic
1020640150 7:10744470-10744492 TGTCTAATATTGACAATGGGTGG - Intergenic
1022843206 7:34184144-34184166 TATGTAATGATGACAGTGTGAGG - Intergenic
1023088062 7:36592228-36592250 TTTCTGATGTTGAAATTGGGGGG + Intronic
1026923950 7:74175903-74175925 TGTCAAATTTTGACATTTGGGGG + Intronic
1027553572 7:79633379-79633401 TTTATATGGTTGACAGTGGGTGG - Intergenic
1029907924 7:104111031-104111053 TTTCAAATGCTGACAGTGAGAGG - Intergenic
1030593510 7:111508926-111508948 TTTCTAATATTGAGAGTGGCAGG - Intronic
1031081290 7:117259530-117259552 TTTCTAATTGTCACAGTGGGAGG + Intergenic
1031690291 7:124779869-124779891 TGTGTAATCTTGACACTGTGTGG + Intronic
1031711268 7:125048869-125048891 TGTCTAATATTGACAGTGGGGGG - Intergenic
1032903790 7:136340700-136340722 TAGCTAATGTTCAGAGTGGGTGG - Intergenic
1033054594 7:138038617-138038639 TGGCTAATATTGACAGTGGGGGG - Intronic
1034106613 7:148495944-148495966 TGTGTTAAGTTGTCAGTGGGGGG + Intergenic
1034954586 7:155326761-155326783 TTTCTTATGCTTACAGTGGGGGG + Intergenic
1041429313 8:57761125-57761147 TGTCTAATATTGTTAGTGGGAGG - Intergenic
1041623903 8:60003057-60003079 TGTCTAATATTGTCAGTATGGGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1046735767 8:117775430-117775452 TGTCTAATACTGTCAGTGGAGGG - Intergenic
1047679447 8:127239369-127239391 TGTCTAATATTCACAGTGCTTGG - Intergenic
1050049716 9:1586997-1587019 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1050083882 9:1943653-1943675 TTTATAAGGTTGCCAGTGGGAGG + Intergenic
1051992322 9:23166410-23166432 TGTCTAATCCTGAAAGTGAGAGG - Intergenic
1052343753 9:27387943-27387965 TGCCAAATGTTGCCTGTGGGGGG - Intronic
1052465422 9:28823215-28823237 TGTCAAATGTTAGCAGTAGGGGG + Intergenic
1052544339 9:29854226-29854248 TATCTAATGTTGAAATTGGAAGG + Intergenic
1053260116 9:36655398-36655420 TGTATTCTGTTGACAGTGGCTGG + Intronic
1054872850 9:70065072-70065094 TGTGTGATTTTGACAGAGGGAGG - Intronic
1055207373 9:73749244-73749266 TGTTTAATGCTGTCAGTAGGGGG + Intergenic
1058441698 9:105014400-105014422 TGTTTAATGCTGTCAGTGGCAGG + Intergenic
1060131168 9:121100974-121100996 GATCTAACATTGACAGTGGGGGG - Intronic
1061375366 9:130220827-130220849 TTTCTAATGTTGACTGTAGCAGG + Intronic
1186280221 X:7985071-7985093 TGTTTAATGTTTACAGGGGCTGG + Intergenic
1188806728 X:34600011-34600033 TGTCTAATGCTGTCAGTGGAGGG + Intergenic
1189443577 X:41059724-41059746 TGTCTAAGGTTGCCATTAGGTGG + Intergenic
1190559784 X:51675657-51675679 TGGCTAATGATGATTGTGGGTGG + Intergenic
1190564507 X:51717664-51717686 TGGCTAATGATGATTGTGGGTGG - Intergenic
1190806062 X:53838026-53838048 TGTGTAATGTTGACACAGCGGGG + Intergenic
1191183524 X:57586576-57586598 TCACTAAGGTTGTCAGTGGGAGG + Intergenic
1191213858 X:57915823-57915845 TCACTAAGGTTGTCAGTGGGAGG - Intergenic
1192720603 X:73693221-73693243 TGTGTAATATTGACAGTGGGGGG - Intergenic
1193211640 X:78812953-78812975 TGTCCAATGGTAAGAGTGGGGGG - Intergenic
1195622293 X:106968897-106968919 TGTCTAACGTTGACAATGGAGGG - Intronic
1195723328 X:107888694-107888716 TGTCTAATGTTGACAATGCGGGG + Intronic
1197017520 X:121644758-121644780 TATCAAATGTGGACAGTGTGTGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198264595 X:134997684-134997706 TTGCTAATCTTGGCAGTGGGAGG + Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1199281017 X:145999293-145999315 TGGCTAATGCTGACAGTTTGTGG - Intergenic
1199500317 X:148500445-148500467 TAGCTGATTTTGACAGTGGGGGG + Intergenic
1199673769 X:150167286-150167308 TGGCTAATGTGAACAGAGGGAGG - Intergenic
1201358876 Y:13124797-13124819 TATCTAATGATGAGAGTGAGGGG + Intergenic
1202023870 Y:20499130-20499152 TATCTAATCTTAACAGTGGGGGG + Intergenic