ID: 1101638207

View in Genome Browser
Species Human (GRCh38)
Location 12:106565108-106565130
Sequence TACCTATGGCTCCCAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101638207_1101638210 3 Left 1101638207 12:106565108-106565130 CCAGTCACTGGGAGCCATAGGTA 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1101638210 12:106565134-106565156 CTGTGATGGTAGCCACAGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101638207 Original CRISPR TACCTATGGCTCCCAGTGAC TGG (reversed) Intronic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
905623844 1:39473782-39473804 TACCTTTGGATCCCAGTGCGAGG - Intronic
905671428 1:39792901-39792923 TACCTTTGGATCCCAGTGCGAGG + Intergenic
909762600 1:79310895-79310917 TAATTATAGCTGCCAGTGACTGG - Intergenic
911042378 1:93600868-93600890 TACCTTTGGCTCCCAGAGCCTGG + Intronic
924620451 1:245655662-245655684 TATCTGTGTATCCCAGTGACTGG + Intronic
1063706535 10:8436404-8436426 TGCCTATGGATCCAAGAGACTGG + Intergenic
1073085431 10:100885371-100885393 TGCCTCAGGCTCCCAGTGTCGGG + Intergenic
1074283267 10:112073367-112073389 GACCAATGGCCCCCAGCGACCGG - Intergenic
1077029884 11:460496-460518 GACTCCTGGCTCCCAGTGACAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083719767 11:64598463-64598485 TGCCTGTGGCCCCCAGTGCCTGG - Intronic
1089276782 11:117342174-117342196 TACTCATGGCTCATAGTGACTGG + Intronic
1090900693 11:131028114-131028136 TACCTCTTGCTCTCAATGACGGG + Intergenic
1091481375 12:835222-835244 TACCTCAGCCTCCCAGTGGCTGG - Intronic
1092277029 12:7069290-7069312 GACCTCTCACTCCCAGTGACTGG - Intronic
1097261391 12:57722244-57722266 TGCCTCAGCCTCCCAGTGACTGG + Intergenic
1101638207 12:106565108-106565130 TACCTATGGCTCCCAGTGACTGG - Intronic
1102713485 12:114949347-114949369 TTTCTTTGTCTCCCAGTGACAGG - Intergenic
1104672159 12:130688344-130688366 TTCCTGTGGCTCCCTGAGACCGG - Intronic
1108020361 13:46121855-46121877 TCTCTATGACTTCCAGTGACAGG - Intergenic
1109340787 13:61055621-61055643 TACCTATGGCTGGCAGATACTGG + Intergenic
1112021155 13:95372413-95372435 TATTTAGGGCTCCCAGGGACAGG + Intergenic
1115976929 14:39007074-39007096 TGCCTCTGCCTCCCAGTAACTGG + Intergenic
1119735139 14:76976767-76976789 TCCCCAGGGCTCCCAGTGAAAGG - Intergenic
1120746804 14:88159557-88159579 GACCTTTGGCTCCCAGTGAAGGG - Intergenic
1122823429 14:104358499-104358521 CACCCATGGCTCCCAGTGCCTGG - Intergenic
1124652207 15:31482568-31482590 CAGCGATGGCTCCCAGTGCCGGG - Exonic
1124658093 15:31524710-31524732 GAACTATGGCTCCCAGGGGCAGG + Intronic
1125736559 15:41930788-41930810 TTCCCATGGTTCCCACTGACTGG - Intronic
1133263431 16:4568031-4568053 TGCCAATGGCTCCCATAGACAGG - Intronic
1135210175 16:20519161-20519183 TACCTCTGATTCCCAGAGACAGG + Intergenic
1136283641 16:29229065-29229087 TACCCATGGCTAGCAGTGACAGG + Intergenic
1137748787 16:50842669-50842691 TGCCTCTGCCTCCCAGTCACTGG + Intergenic
1142088673 16:88198576-88198598 TACCCATGGCTAGCAGTGACAGG + Intergenic
1145883770 17:28369218-28369240 GAGCTATTGCTCCCAGGGACAGG - Intronic
1152295900 17:79466743-79466765 TTGCTATGGGGCCCAGTGACTGG + Intronic
1161581509 19:5083350-5083372 TGCCTTGGGGTCCCAGTGACGGG + Intronic
1161701785 19:5799914-5799936 GACCTAAGGCCCCCAGGGACGGG + Intergenic
1162103413 19:8354475-8354497 TACCTATGCCTCCCAGCTTCAGG - Intronic
928283900 2:29972386-29972408 AAGTTATGGCTCCCAGTGCCAGG + Intergenic
928334988 2:30390326-30390348 TAGCCATGGCTCCCACTGACTGG - Intergenic
930698571 2:54436408-54436430 TACTTAGGGCTCCAATTGACTGG + Intergenic
932551109 2:72770314-72770336 TAGCTTTGGCTCACAGTTACTGG - Intronic
936014327 2:108946278-108946300 TACCTACGGGTGACAGTGACGGG + Intronic
940055398 2:149507683-149507705 TACCTTTGGCTTCCAGTTTCTGG - Intergenic
942866311 2:180679719-180679741 TGCCTTTGTCTCCCAGTGGCAGG + Intergenic
945022938 2:205592332-205592354 TCCCTTTCTCTCCCAGTGACTGG - Intronic
946169600 2:217886813-217886835 TACCTAGGGCTCCCAGCAGCAGG - Intronic
947840977 2:233207924-233207946 TATCTATGGCTCCGAATGTCAGG - Intergenic
1168868515 20:1109191-1109213 TGCCTCTGCCTCCCAGTGGCTGG - Intergenic
1176077732 20:63255980-63256002 CACCAATGGCTCCAAGTGCCTGG - Intronic
1179571481 21:42281238-42281260 TTGCTATGGCTCCCAGGGGCCGG + Intronic
1184497571 22:44851094-44851116 TACCTCTGCCTCCCAGTCCCCGG + Intronic
953117835 3:40010338-40010360 TTCCTGTGCCTCCCAGTGCCTGG + Intronic
954577560 3:51685000-51685022 GACCTGAGGCTCCCAGTGTCTGG + Intronic
955069158 3:55557757-55557779 TCCCTATGGCTTCCAGCCACAGG + Intronic
967965994 3:194960734-194960756 CACCTCTGGCTCCCAGAGAGGGG + Intergenic
970357876 4:15275596-15275618 AACCTATGCCCTCCAGTGACAGG - Intergenic
975299889 4:72777344-72777366 TAGCTATGACTCACAGTGATTGG - Intergenic
976336449 4:83893614-83893636 TGCCTTTGGCTGCAAGTGACAGG + Intergenic
976963969 4:91012375-91012397 TACCTCTGGCCCCAAGGGACAGG + Intronic
981882847 4:149636386-149636408 TACGTAGGGCTTCCACTGACTGG + Intergenic
990352512 5:54933032-54933054 AACCTGTGGCTCTCACTGACAGG - Intergenic
992193260 5:74314932-74314954 GTCCTTGGGCTCCCAGTGACTGG - Intergenic
992294879 5:75317855-75317877 TACCCATGGATAACAGTGACAGG + Intergenic
996283400 5:121759532-121759554 TCCCTATTGCTGCAAGTGACAGG - Intergenic
996928798 5:128861351-128861373 TACCTCAGCCTCCCAGTGGCTGG + Intronic
997615118 5:135240807-135240829 TACCTCTGGGTCCCAGGGGCAGG + Intronic
1001685678 5:173593179-173593201 TACCCAAGGCTCACAGTGAGTGG - Intergenic
1013606259 6:111751733-111751755 TACCTACGCCTCCCAGTACCTGG + Intronic
1013934067 6:115571951-115571973 TACCTATGGACCCCAGGGAAGGG - Intergenic
1015197040 6:130535526-130535548 TAAGTATGGCTCCCAGAGACTGG - Intergenic
1021351525 7:19599989-19600011 TACCAATGTCTCCCAGGTACAGG - Intergenic
1022684794 7:32586548-32586570 TTCCTATGGCTCACAGAGCCAGG - Exonic
1022889485 7:34681886-34681908 TATCCATGGTTCCCAGTGAGTGG - Intronic
1025951558 7:66149656-66149678 AACCTAAGGTTCCCAGTCACAGG + Intronic
1026504423 7:70970089-70970111 TCCCTGTGGCTCCTAGTGGCGGG - Intergenic
1032571590 7:133005979-133006001 TACATATAGGTCTCAGTGACAGG + Intronic
1033682136 7:143604907-143604929 TACCTCTGCCTCCCAGGGTCTGG + Intergenic
1033702754 7:143857006-143857028 TACCTCTGCCTCCCAGGGTCTGG - Intronic
1034092525 7:148377159-148377181 TCCCAGTGGCTCCCAGTGTCAGG - Intronic
1036054037 8:5230321-5230343 TACTTATGGCTACCAATAACAGG - Intergenic
1037970768 8:23170250-23170272 TACAAATGTCTCCCAGGGACCGG - Intergenic
1038732843 8:30142604-30142626 TGCCTCTGCCTCCCAGTTACTGG + Intronic
1039610323 8:38914261-38914283 CACATATGGATACCAGTGACTGG - Intronic
1040071379 8:43191576-43191598 TACGTAGGGCACCCAGGGACTGG - Exonic
1040981684 8:53251445-53251467 TACCTATGGTTCCCAGAGACAGG + Exonic
1045187739 8:99856074-99856096 TACCTGTGGCACCAAGTAACGGG + Intronic
1048921559 8:139236004-139236026 TACCTAAGGATACCAGTCACTGG + Intergenic
1048939455 8:139385745-139385767 TCACTAAGGCACCCAGTGACAGG + Intergenic
1049852027 8:144837822-144837844 AACCTATGGATCCAAGTGAAGGG + Intronic
1060021130 9:120132207-120132229 TACCTGTCTGTCCCAGTGACAGG + Intergenic
1060213128 9:121722588-121722610 AACCCAGGGCTCCCACTGACTGG + Intronic
1060797143 9:126520330-126520352 TGCCTGTGGTCCCCAGTGACCGG + Intergenic
1062003856 9:134229729-134229751 CCCCTCTGGCTCCCAGCGACTGG - Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1185599680 X:1330209-1330231 TACCTCTGCCTCCCAGCTACTGG - Intergenic
1191111314 X:56804872-56804894 TACCCATGCCTCTCAGTGACTGG + Intergenic
1198398706 X:136250042-136250064 TACCTGTGGCTCTCAGGCACTGG - Intronic
1200756938 Y:6999046-6999068 TACCTATGGGTCCAAGGCACTGG + Intronic