ID: 1101638305

View in Genome Browser
Species Human (GRCh38)
Location 12:106565878-106565900
Sequence AAGGGGGTAGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23912
Summary {0: 1, 1: 11, 2: 339, 3: 3937, 4: 19624}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101638305 Original CRISPR AAGGGGGTAGGGAGGGAGGA AGG Intronic
Too many off-targets to display for this crispr